Rmu_sc0000161.1_g000030

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000161.1
OG0000128
Physical Location & Seq
Forward (+)
158024 .. 158629
606 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000161.1_g000030.1.cds

Sequence Viewer

Length: 606 bp
atggagttgagtatagctagtcacaaagggaagaaagagtcaattgttgaccaaaggaaatacaaggtcttcgaaagtaagattgacaaggcaccgaagaaatctacaaaagaatcaatggccgtcaacattgccctaatcaaaatatgtacacgagagaaggaggttaagaaagcagagccaactcgcccctacgacagaacaaagcgttcgttgaaggaatggcaacaaaagacatatcccttcccagattctaacgttgcaggcatgttggaagatttacttgagaagaaggtgatagatctcccagaatgcaagcggcccaaggaagtgcatcatgtcaaggacccaaaatattgtaggtaccaccagatcgttagtcacccagtcgagaaatgcttcgttatgaaagatttaacaatgaatcttgccaagcaaggaaggattgagctggatgtcgacgatgttgctgaggtaaactacactaccatcgtgtttgggtcatttgagctttcctcgttgccttctcttctaatgaaagtaccttatcagctttcgagaaagccatgcataaagtcaaagttagaggaagtcaagccaatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 Retrotrans_gag

Protein Analysis

201

Amino Acids

23.29

Weight (kDa)

9.32

Isoelectric Point (pI)

37.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 363
AccB1I GGYRCC 2 cut(s) 91, 363
AccI GTMKAC 1 cut(s) 459
AciI CCGC 1 cut(s) 319
AclI AACGTT 1 cut(s) 258
AcoI YGGCCR 1 cut(s) 120
AfaI GTAC 3 cut(s) 151, 365, 543
AgsI TTSAA 1 cut(s) 217
AluBI AGCT 4 cut(s) 17, 451, 511, 553
AluI AGCT 4 cut(s) 17, 451, 511, 553
AoxI GGCC 2 cut(s) 120, 320
Asp700I GAANNNNTTC 1 cut(s) 398
Asp718I GGTACC 1 cut(s) 363
AspS9I GGNCC 2 cut(s) 321, 346
AsuHPI GGTGA 2 cut(s) 307, 374
AsuII TTCGAA 1 cut(s) 72
AvaII GGWCC 1 cut(s) 346
BanI GGYRCC 2 cut(s) 91, 363
BauI CACGAG 1 cut(s) 153
BbsI GAAGAC 1 cut(s) 61
BbvCI CCTCAGC 1 cut(s) 471
BccI CCATC 1 cut(s) 497
BceAI ACGGC 1 cut(s) 107
BcgI CGANNNNNNTGC 2 cut(s) 449, 483
BfaI CTAG 2 cut(s) 18, 604
BglII AGATCT 1 cut(s) 301
BisI GCNGC 1 cut(s) 320
BlsI GCNGC 1 cut(s) 321
Bme18I GGWCC 1 cut(s) 346
BmgT120I GGNCC 2 cut(s) 321, 346
BmiI GGNNCC 3 cut(s) 93, 348, 365
BmrI ACTGGG 1 cut(s) 380
BmsI GCATC 1 cut(s) 343
BmuI ACTGGG 1 cut(s) 380
BpiI GAAGAC 1 cut(s) 61
BplI GAGNNNNNCTC 2 cut(s) 500, 532
Bpu10I CCTNAGC 1 cut(s) 471
Bpu14I TTCGAA 1 cut(s) 72
BpuEI CTTGAG 1 cut(s) 305
BsaJI CCNNGG 1 cut(s) 324
Bse1I ACTGG 1 cut(s) 386
Bse3DI GCAATG 1 cut(s) 129
BseDI CCNNGG 1 cut(s) 324
BseGI GGATG 1 cut(s) 460
BseMI GCAATG 1 cut(s) 129
BseMII CTCAG 1 cut(s) 462
BseNI ACTGG 1 cut(s) 386
BshFI GGCC 2 cut(s) 122, 322
BshNI GGYRCC 2 cut(s) 91, 363
BsmI GAATGC 1 cut(s) 317
BsnI GGCC 2 cut(s) 122, 322
Bsp119I TTCGAA 1 cut(s) 72
Bsp1407I TGTACA 1 cut(s) 149
Bsp143I GATC 2 cut(s) 301, 372
BspACI CCGC 1 cut(s) 319
BspANI GGCC 2 cut(s) 122, 322
BspCNI CTCAG 1 cut(s) 463
BspLI GGNNCC 3 cut(s) 93, 348, 365
BspT104I TTCGAA 1 cut(s) 72
BspT107I GGYRCC 2 cut(s) 91, 363
BsrDI GCAATG 1 cut(s) 129
BsrGI TGTACA 1 cut(s) 149
BsrI ACTGG 1 cut(s) 386
BssECI CCNNGG 1 cut(s) 324
BssMI GATC 2 cut(s) 301, 372
BssSI CACGAG 1 cut(s) 153
BssT1I CCWWGG 1 cut(s) 324
Bst2BI CACGAG 1 cut(s) 153
Bst6I CTCTTC 1 cut(s) 534
BstAUI TGTACA 1 cut(s) 149
BstBI TTCGAA 1 cut(s) 72
BstC8I GCNNGC 2 cut(s) 265, 317
BstDEI CTNAG 1 cut(s) 471
BstF5I GGATG 1 cut(s) 460
BstKTI GATC 2 cut(s) 304, 375
BstMBI GATC 2 cut(s) 301, 372
BstNSI RCATGY 1 cut(s) 271
BstV2I GAAGAC 1 cut(s) 61
BstX2I RGATCY 1 cut(s) 301
BstYI RGATCY 1 cut(s) 301
BsuRI GGCC 2 cut(s) 122, 322
BtsCI GGATG 1 cut(s) 460
Cac8I GCNNGC 2 cut(s) 265, 317
Cfr13I GGNCC 2 cut(s) 321, 346
Csp6I GTAC 3 cut(s) 150, 364, 542
CviAII CATG 3 cut(s) 268, 338, 567
CviJI RGCY 9 cut(s) 17, 122, 181, 322, 451, 511, 553, 565, 598
CviKI_1 RGCY 9 cut(s) 17, 122, 181, 322, 451, 511, 553, 565, 598
CviQI GTAC 3 cut(s) 150, 364, 542
DdeI CTNAG 1 cut(s) 471
DpnI GATC 2 cut(s) 303, 374
DpnII GATC 2 cut(s) 301, 372
EaeI YGGCCR 1 cut(s) 120
Eam1104I CTCTTC 1 cut(s) 534
EarI CTCTTC 1 cut(s) 534
Eco130I CCWWGG 1 cut(s) 324
Eco47I GGWCC 1 cut(s) 346
EcoO109I RGGNCCY 1 cut(s) 346
EcoT14I CCWWGG 1 cut(s) 324
EcoT22I ATGCAT 1 cut(s) 572
ErhI CCWWGG 1 cut(s) 324
FaeI CATG 3 cut(s) 271, 341, 570
FaiI YATR 8 cut(s) 14, 148, 238, 269, 339, 407, 568, 572
FalI AAGNNNNNCTT 2 cut(s) 267, 299
FatI CATG 3 cut(s) 267, 337, 566
FblI GTMKAC 1 cut(s) 459
Fnu4HI GCNGC 1 cut(s) 320
FokI GGATG 1 cut(s) 467
Fsp4HI GCNGC 1 cut(s) 320
FspBI CTAG 2 cut(s) 18, 604
GluI GCNGC 1 cut(s) 320
HaeIII GGCC 2 cut(s) 122, 322
Hin1II CATG 3 cut(s) 271, 341, 570
HincII GTYRAC 3 cut(s) 49, 127, 460
HindII GTYRAC 3 cut(s) 49, 127, 460
HinfI GANTC 4 cut(s) 38, 113, 251, 424
HphI GGTGA 2 cut(s) 307, 374
Hpy166II GTNNAC 5 cut(s) 49, 127, 152, 460, 478
Hpy188III TCNNGA 2 cut(s) 391, 558
Hpy8I GTNNAC 5 cut(s) 49, 127, 152, 460, 478
Hpy99I CGWCG 1 cut(s) 464
HpyAV CCTTC 6 cut(s) 154, 211, 253, 286, 435, 534
HpyCH4IV ACGT 1 cut(s) 258
HpyCH4V TGCA 4 cut(s) 263, 315, 334, 570
HpyF3I CTNAG 1 cut(s) 471
HpySE526I ACGT 1 cut(s) 258
Hsp92II CATG 3 cut(s) 271, 341, 570
KpnI GGTACC 1 cut(s) 367
Kzo9I GATC 2 cut(s) 301, 372
LpnPI CCDG 6 cut(s) 249, 261, 321, 383, 399, 437
LweI GCATC 1 cut(s) 343
MaeI CTAG 2 cut(s) 18, 604
MaeII ACGT 1 cut(s) 258
MaeIII GTNAC 2 cut(s) 20, 380
MalI GATC 2 cut(s) 303, 374
MboI GATC 2 cut(s) 301, 372
MboII GAAGA 6 cut(s) 43, 61, 109, 287, 301, 521
MfeI CAATTG 1 cut(s) 42
MflI RGATCY 1 cut(s) 301
MluCI AATT 1 cut(s) 42
MlyI GAGTC 1 cut(s) 47
MmeI TCCRAC 1 cut(s) 252
MnlI CCTC 4 cut(s) 157, 466, 526, 580
Mph1103I ATGCAT 1 cut(s) 572
MroXI GAANNNNTTC 1 cut(s) 398
MseI TTAA 2 cut(s) 168, 416
MunI CAATTG 1 cut(s) 42
Mva1269I GAATGC 1 cut(s) 317
NdeII GATC 2 cut(s) 301, 372
NlaIII CATG 3 cut(s) 271, 341, 570
NlaIV GGNNCC 3 cut(s) 93, 348, 365
NmuCI GTSAC 2 cut(s) 20, 380
NsiI ATGCAT 1 cut(s) 572
NspI RCATGY 1 cut(s) 271
NspV TTCGAA 1 cut(s) 72
PctI GAATGC 1 cut(s) 317
PdmI GAANNNNTTC 1 cut(s) 398
PfeI GAWTC 3 cut(s) 113, 251, 424
PkrI GCNGC 1 cut(s) 321
PleI GAGTC 1 cut(s) 46
PpsI GAGTC 1 cut(s) 46
PpuMI RGGWCCY 1 cut(s) 346
Psp1406I AACGTT 1 cut(s) 258
Psp5II RGGWCCY 1 cut(s) 346
PspN4I GGNNCC 3 cut(s) 93, 348, 365
PspPI GGNCC 2 cut(s) 321, 346
PspPPI RGGWCCY 1 cut(s) 346
PsuI RGATCY 1 cut(s) 301
RsaI GTAC 3 cut(s) 151, 365, 543
RsaNI GTAC 3 cut(s) 150, 364, 542
SalI GTCGAC 1 cut(s) 458
SaqAI TTAA 2 cut(s) 168, 416
SatI GCNGC 1 cut(s) 320
Sau3AI GATC 2 cut(s) 301, 372
Sau96I GGNCC 2 cut(s) 321, 346
SchI GAGTC 1 cut(s) 47
SfaNI GCATC 1 cut(s) 343
SfuI TTCGAA 1 cut(s) 72
SinI GGWCC 1 cut(s) 346
SmlI CTYRAG 1 cut(s) 284
SmoI CTYRAG 1 cut(s) 284
Sse9I AATT 1 cut(s) 42
SsiI CCGC 1 cut(s) 319
SspI AATATT 1 cut(s) 356
SspMI CTAG 2 cut(s) 18, 604
StyI CCWWGG 1 cut(s) 324
TaiI ACGT 1 cut(s) 261
TaqI TCGA 4 cut(s) 72, 390, 459, 557
TasI AATT 1 cut(s) 42
TatI WGTACW 1 cut(s) 149
TauI GCSGC 1 cut(s) 322
TfiI GAWTC 3 cut(s) 113, 251, 424
Tru1I TTAA 2 cut(s) 168, 416
Tru9I TTAA 2 cut(s) 168, 416
TseFI GTSAC 2 cut(s) 20, 380
Tsp45I GTSAC 2 cut(s) 20, 380
TspDTI ATGAA 3 cut(s) 422, 437, 551
VpaK11BI GGWCC 1 cut(s) 346
XceI RCATGY 1 cut(s) 271
XmiI GTMKAC 1 cut(s) 459
XmnI GAANNNNTTC 1 cut(s) 398
XspI CTAG 2 cut(s) 18, 604
Zsp2I ATGCAT 1 cut(s) 572
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.