Rw1G005460

Retrotransposon gag protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
10749709 .. 10750952
1244 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G005460.1

Sequence Viewer

Length: 1092 bp
ATGGAGAAGTTAGAAACTCAACGTGGCGATGACTCAGAAAAAGGTCTGCGTGGTCATAAGAAAGACTCATCTAGCAAATCATTTTCTGAACAAAAAGAAGAATCAAATTTCATTCTAGCTTCATGGTCAATTCAACAACTTCAAGACATGATTGCTAACACGATCAGAGCTCAATATGGTGGTCCATCTCAGGATACACTAACGTATTCCAAACCTTATACGAAGCGGCTCGACAATTTGAGGATGCCAACTGGATACCAGCCTCCCAAGTTTCAACAATTCGATGGCAAAGAATTGGAGTCTGAATCCATTGACAGCTGGGAGCAAATGGAAAAAGAGTTCTTGAATCGCTTCTTCAGTACACGTCGCATTGTGAGCATGTTAGAGCTCACCAACACCAAACAACAGAATGACGAGTCGGCTATAGAATTCATCAACCGTTGGCGTGCACTAAGCCTCGACTGCAAGGATCGACTCTCAGAGTTGTCAGCAGTAGAAATGTGCATTCAAGGCATGCATTGGCCTCGCACCTTTGAAGAACTTGCCACTCGAGCTCATGGCATGGAATTTAGCATCGCTAGTCATAGTCAAAGAAAAGATGAAATCGTTGAATCACATAATCAGAAACGTGTCATGGAGTCTTTGGCGATCACAACTCCTGTCAAGATCACAGCACGAGTCAAGTCAAATAACCAAAACAAGTTGGAGCCGACTCATGATCAAACAAGGCGGCGCACTCTTAAAGAGCTAGAAGCTAAAAGTTACCCTTTTCCAGATTCCGATGTTGCTGACATGTTGGAAGATTTGCTTCAAAAGAAAGTAATTAAATTGCCATACTGCAAACGTCCAGAAGAGATGCATCGCATCAATGAACCAAAGTATTGCAAATACCACCGTGTCATCGGTCACCCGACAGAGAAGTGCTTTATGTTGAAAGACCTCATCATGAAGCTTGCACAACAAGGAAAAATCTGTTTAGACATTGAAGATGACGTGGCTCAATCAAATCATACTGCTATCATCTTTGATCAACTTGAAGCAGAGTCGTCATCGCCTTTGCTGGGGGCATGCTACTTGCCCAAATTGCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

363

Amino Acids

42.13

Weight (kDa)

6.4

Isoelectric Point (pI)

54.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotrans_gag PF03732 98 - 173 8.3e-08 Retrotransposon gag protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 226, 730
AclWI GGATC 1 cut(s) 477
AcsI RAATTY 3 cut(s) 106, 428, 566
AcuI CTGAAG 1 cut(s) 340
AfaI GTAC 1 cut(s) 361
AfiI CCNNNNNNNGG 1 cut(s) 1061
AflIII ACRYGT 3 cut(s) 362, 628, 792
AjiI CACGTC 2 cut(s) 365, 994
AloI GAACNNNNNNTCC 2 cut(s) 323, 355
AluBI AGCT 8 cut(s) 119, 170, 318, 388, 554, 748, 755, 952
AluI AGCT 8 cut(s) 119, 170, 318, 388, 554, 748, 755, 952
Alw21I GWGCWC 4 cut(s) 172, 390, 451, 556
Alw44I GTGCAC 1 cut(s) 447
AlwI GGATC 1 cut(s) 477
Ama87I CYCGRG 1 cut(s) 549
AoxI GGCC 1 cut(s) 521
ApaLI GTGCAC 1 cut(s) 447
ApoI RAATTY 3 cut(s) 106, 428, 566
Asp700I GAANNNNTTC 1 cut(s) 350
AspLEI GCGC 1 cut(s) 735
AspS9I GGNCC 1 cut(s) 182
AsuHPI GGTGA 2 cut(s) 382, 899
AvaI CYCGRG 1 cut(s) 549
AvaII GGWCC 1 cut(s) 182
BaeGI GKGCMC 1 cut(s) 451
BanII GRGCYC 3 cut(s) 172, 390, 556
BauI CACGAG 1 cut(s) 675
Bbv12I GWGCWC 4 cut(s) 172, 390, 451, 556
BccI CCATC 2 cut(s) 193, 278
BcgI CGANNNNNNTGC 2 cut(s) 506, 540
BciVI GTATCC 2 cut(s) 187, 248
BclI TGATCA 2 cut(s) 718, 1027
BfaI CTAG 4 cut(s) 72, 116, 579, 749
BfmI CTRYAG 1 cut(s) 423
BfuI GTATCC 2 cut(s) 187, 248
BisI GCNGC 2 cut(s) 227, 731
BlsI GCNGC 2 cut(s) 228, 732
Bme18I GGWCC 1 cut(s) 182
BmeT110I CYCGRG 1 cut(s) 549
BmgBI CACGTC 2 cut(s) 365, 994
BmgT120I GGNCC 1 cut(s) 182
BmiI GGNNCC 1 cut(s) 708
BmsI GCATC 5 cut(s) 234, 582, 846, 868, 873
Bsc4I CCNNNNNNNGG 1 cut(s) 1061
Bse1I ACTGG 1 cut(s) 256
BseGI GGATG 1 cut(s) 249
BseLI CCNNNNNNNGG 1 cut(s) 1061
BseMII CTCAG 3 cut(s) 48, 203, 492
BseNI ACTGG 1 cut(s) 256
BseSI GKGCMC 1 cut(s) 451
BseYI CCCAGC 2 cut(s) 318, 1060
BshFI GGCC 1 cut(s) 523
BsiHKAI GWGCWC 4 cut(s) 172, 390, 451, 556
BsiHKCI CYCGRG 1 cut(s) 549
BslI CCNNNNNNNGG 1 cut(s) 1061
BsmI GAATGC 1 cut(s) 504
BsnI GGCC 1 cut(s) 523
BsoBI CYCGRG 1 cut(s) 549
Bsp1286I GDGCHC 4 cut(s) 172, 390, 451, 556
Bsp143I GATC 6 cut(s) 162, 469, 648, 666, 718, 1027
BspACI CCGC 2 cut(s) 226, 730
BspANI GGCC 1 cut(s) 523
BspCNI CTCAG 3 cut(s) 47, 202, 491
BspHI TCATGA 2 cut(s) 715, 945
BspLI GGNNCC 1 cut(s) 708
BspPI GGATC 1 cut(s) 477
BsrI ACTGG 1 cut(s) 256
BssMI GATC 6 cut(s) 162, 469, 648, 666, 718, 1027
BssSI CACGAG 1 cut(s) 675
Bst2BI CACGAG 1 cut(s) 675
Bst4CI ACNGT 2 cut(s) 440, 896
Bst6I CTCTTC 1 cut(s) 846
BstC8I GCNNGC 4 cut(s) 447, 515, 954, 1069
BstDEI CTNAG 5 cut(s) 34, 189, 452, 478, 1089
BstEII GGTNACC 1 cut(s) 905
BstF5I GGATG 1 cut(s) 249
BstHHI GCGC 1 cut(s) 735
BstKTI GATC 6 cut(s) 165, 472, 651, 669, 721, 1030
BstMBI GATC 6 cut(s) 162, 469, 648, 666, 718, 1027
BstMWI GCNNNNNNNGC 5 cut(s) 375, 462, 510, 551, 1084
BstNSI RCATGY 4 cut(s) 382, 517, 796, 1071
BstPI GGTNACC 1 cut(s) 905
BstSFI CTRYAG 1 cut(s) 423
BstSLI GKGCMC 1 cut(s) 451
BsuI GTATCC 2 cut(s) 187, 248
BsuRI GGCC 1 cut(s) 523
BtgZI GCGATG 4 cut(s) 42, 559, 845, 1035
BtrI CACGTC 2 cut(s) 365, 994
BtsCI GGATG 1 cut(s) 249
Cac8I GCNNGC 4 cut(s) 447, 515, 954, 1069
CciI TCATGA 2 cut(s) 715, 945
CfoI GCGC 1 cut(s) 735
Cfr13I GGNCC 1 cut(s) 182
Csp6I GTAC 1 cut(s) 360
CviQI GTAC 1 cut(s) 360
DdeI CTNAG 5 cut(s) 34, 189, 452, 478, 1089
DpnI GATC 6 cut(s) 164, 471, 650, 668, 720, 1029
DpnII GATC 6 cut(s) 162, 469, 648, 666, 718, 1027
Eam1104I CTCTTC 1 cut(s) 846
EarI CTCTTC 1 cut(s) 846
Ecl136II GAGCTC 3 cut(s) 170, 388, 554
Eco24I GRGCYC 3 cut(s) 172, 390, 556
Eco47I GGWCC 1 cut(s) 182
Eco53kI GAGCTC 3 cut(s) 170, 388, 554
Eco57I CTGAAG 1 cut(s) 340
Eco88I CYCGRG 1 cut(s) 549
Eco91I GGTNACC 1 cut(s) 905
EcoICRI GAGCTC 3 cut(s) 170, 388, 554
EcoO65I GGTNACC 1 cut(s) 905
EcoRI GAATTC 1 cut(s) 428
EcoT22I ATGCAT 2 cut(s) 519, 861
EcoT38I GRGCYC 3 cut(s) 172, 390, 556
FalI AAGNNNNNCTT 4 cut(s) 751, 783, 792, 824
FbaI TGATCA 2 cut(s) 718, 1027
Fnu4HI GCNGC 2 cut(s) 227, 731
FokI GGATG 1 cut(s) 256
FriOI GRGCYC 3 cut(s) 172, 390, 556
Fsp4HI GCNGC 2 cut(s) 227, 731
FspBI CTAG 4 cut(s) 72, 116, 579, 749
GlaI GCGC 1 cut(s) 734
GluI GCNGC 2 cut(s) 227, 731
GsaI CCCAGC 2 cut(s) 322, 1064
HaeIII GGCC 1 cut(s) 523
HhaI GCGC 1 cut(s) 735
Hin6I GCGC 1 cut(s) 733
HinP1I GCGC 1 cut(s) 733
HindIII AAGCTT 1 cut(s) 950
HphI GGTGA 2 cut(s) 382, 899
Hpy166II GTNNAC 2 cut(s) 362, 449
Hpy188I TCNGA 7 cut(s) 37, 88, 167, 304, 481, 624, 781
Hpy188III TCNNGA 8 cut(s) 143, 191, 343, 664, 716, 773, 848, 946
Hpy8I GTNNAC 2 cut(s) 362, 449
Hpy99I CGWCG 1 cut(s) 369
HpyCH4III ACNGT 2 cut(s) 440, 896
HpyCH4IV ACGT 6 cut(s) 22, 203, 364, 628, 844, 993
HpyCH4V TGCA 8 cut(s) 449, 465, 504, 517, 840, 859, 885, 956
HpyF10VI GCNNNNNNNGC 5 cut(s) 375, 462, 510, 551, 1084
HpyF3I CTNAG 5 cut(s) 34, 189, 452, 478, 1089
HpySE526I ACGT 6 cut(s) 22, 203, 364, 628, 844, 993
HspAI GCGC 1 cut(s) 733
Ksp22I TGATCA 2 cut(s) 718, 1027
Kzo9I GATC 6 cut(s) 162, 469, 648, 666, 718, 1027
LmnI GCTCC 2 cut(s) 322, 706
LpnPI CCDG 8 cut(s) 176, 237, 272, 304, 672, 786, 861, 1046
LweI GCATC 5 cut(s) 234, 582, 846, 868, 873
MaeI CTAG 4 cut(s) 72, 116, 579, 749
MaeII ACGT 6 cut(s) 22, 203, 364, 628, 844, 993
MaeIII GTNAC 2 cut(s) 761, 905
MalI GATC 6 cut(s) 164, 471, 650, 668, 720, 1029
MboI GATC 6 cut(s) 162, 469, 648, 666, 718, 1027
MboII GAAGA 6 cut(s) 110, 346, 548, 812, 863, 998
MhlI GDGCHC 4 cut(s) 172, 390, 451, 556
MlyI GAGTC 9 cut(s) 26, 59, 308, 425, 468, 647, 687, 706, 1052
MmeI TCCRAC 2 cut(s) 684, 777
MnlI CCTC 5 cut(s) 234, 273, 467, 534, 950
Mph1103I ATGCAT 2 cut(s) 519, 861
MroXI GAANNNNTTC 1 cut(s) 350
MseI TTAA 2 cut(s) 741, 825
MspA1I CMGCKG 1 cut(s) 318
Mva1269I GAATGC 1 cut(s) 504
MwoI GCNNNNNNNGC 5 cut(s) 375, 462, 510, 551, 1084
NdeII GATC 6 cut(s) 162, 469, 648, 666, 718, 1027
NlaIV GGNNCC 1 cut(s) 708
NmuCI GTSAC 1 cut(s) 905
NsiI ATGCAT 2 cut(s) 519, 861
NspI RCATGY 4 cut(s) 382, 517, 796, 1071
PaeI GCATGC 2 cut(s) 517, 1071
PaeR7I CTCGAG 1 cut(s) 549
PagI TCATGA 2 cut(s) 715, 945
PciI ACATGT 1 cut(s) 792
PctI GAATGC 1 cut(s) 504
PdmI GAANNNNTTC 1 cut(s) 350
PfeI GAWTC 5 cut(s) 101, 305, 346, 611, 776
PkrI GCNGC 2 cut(s) 228, 732
PleI GAGTC 9 cut(s) 26, 59, 307, 424, 468, 646, 686, 706, 1051
PpsI GAGTC 9 cut(s) 26, 59, 307, 424, 468, 646, 686, 706, 1051
PscI ACATGT 1 cut(s) 792
Psp124BI GAGCTC 3 cut(s) 172, 390, 556
PspEI GGTNACC 1 cut(s) 905
PspFI CCCAGC 2 cut(s) 318, 1060
PspN4I GGNNCC 1 cut(s) 708
PspPI GGNCC 1 cut(s) 182
PspXI VCTCGAGB 1 cut(s) 549
PvuII CAGCTG 1 cut(s) 318
RsaI GTAC 1 cut(s) 361
RsaNI GTAC 1 cut(s) 360
SacI GAGCTC 3 cut(s) 172, 390, 556
SaqAI TTAA 2 cut(s) 741, 825
SatI GCNGC 2 cut(s) 227, 731
Sau3AI GATC 6 cut(s) 162, 469, 648, 666, 718, 1027
Sau96I GGNCC 1 cut(s) 182
SchI GAGTC 9 cut(s) 26, 59, 308, 425, 468, 647, 687, 706, 1052
SduI GDGCHC 4 cut(s) 172, 390, 451, 556
SfaNI GCATC 5 cut(s) 234, 582, 846, 868, 873
SfcI CTRYAG 1 cut(s) 423
Sfr274I CTCGAG 1 cut(s) 549
SinI GGWCC 1 cut(s) 182
SlaI CTCGAG 1 cut(s) 549
SmlI CTYRAG 1 cut(s) 549
SmoI CTYRAG 1 cut(s) 549
SphI GCATGC 2 cut(s) 517, 1071
SsiI CCGC 2 cut(s) 226, 730
SspMI CTAG 4 cut(s) 72, 116, 579, 749
SstI GAGCTC 3 cut(s) 172, 390, 556
TaaI ACNGT 2 cut(s) 440, 896
TaiI ACGT 6 cut(s) 25, 206, 367, 631, 847, 996
TaqI TCGA 5 cut(s) 231, 282, 459, 472, 550
TaqII GACCGA 1 cut(s) 893
TatI WGTACW 1 cut(s) 359
TauI GCSGC 2 cut(s) 229, 733
TfiI GAWTC 5 cut(s) 101, 305, 346, 611, 776
Tru1I TTAA 2 cut(s) 741, 825
Tru9I TTAA 2 cut(s) 741, 825
TseFI GTSAC 1 cut(s) 905
Tsp45I GTSAC 1 cut(s) 905
TspDTI ATGAA 6 cut(s) 100, 111, 421, 615, 885, 962
VneI GTGCAC 1 cut(s) 447
VpaK11BI GGWCC 1 cut(s) 182
XapI RAATTY 3 cut(s) 106, 428, 566
XceI RCATGY 4 cut(s) 382, 517, 796, 1071
XhoI CTCGAG 1 cut(s) 549
XmnI GAANNNNTTC 1 cut(s) 350
XspI CTAG 4 cut(s) 72, 116, 579, 749
Zsp2I ATGCAT 2 cut(s) 519, 861
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.