Rmu_sc0001241.1_g000019

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001241.1
OG0000128
Physical Location & Seq
Reverse (-)
77654 .. 78520
867 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001241.1_g000019.1.cds

Sequence Viewer

Length: 867 bp
atggcaccacaagttacagtgtatttccaagagcttaaagctattgggtcgaagcctagacaagcaacacgagctggacatcatgtttcattcaccattgatcaacctccactgacaagtaatgttcaaaagctcaaccatggtgtcaaagtcatcaagaccgctacgctcaatgctaaccatgcccctgtcagtactcagataatgatcgggtctattccaatcagtttggttgttacaccacataagcccgaagccccgtgcctcgagtccccacaacaagtatatctacaatcagcgacagctactatagcttctgaacctcagatagtcaagttcatttcgacctctgacagctcatctggcacacaggacaaagttgttaaggcacaccaccaacataatctatcagtggtcaacaaaacaacctctacaactagaaagtccaagaaaacacgtataccaatgggagcattccaagcacataaatcacagggggcatttccagttaatgtaccacagggggccttcccggactcttcagcagaatcaagaccatctatggtccctgtttttagtcaacatactcaagcattgtttgagacaaatgacggcacaaagcctgagactatgtcagttatggtcacaaacgcatcaacaatagaagagcagctagaagaaatgaagagaacgctagctgaaaaaaatgctcaaatagcagcactgacttctcaattggctactatggccaacataagagatcataaaaatgatgaaaagagtgatcgtgaaaagaacatcggaggagtgaaattatgttgggtgacatttacgattttctctcaacatagtttttgctcaacatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

288

Amino Acids

31.37

Weight (kDa)

9.32

Isoelectric Point (pI)

44.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AccI GTMKAC 1 cut(s) 460
AciI CCGC 1 cut(s) 162
AcoI YGGCCR 1 cut(s) 747
AcuI CTGAAG 1 cut(s) 525
AfaI GTAC 2 cut(s) 196, 516
AflIII ACRYGT 1 cut(s) 455
AgsI TTSAA 1 cut(s) 128
AluBI AGCT 9 cut(s) 34, 41, 74, 133, 305, 314, 357, 673, 698
AluI AGCT 9 cut(s) 34, 41, 74, 133, 305, 314, 357, 673, 698
Alw26I GTCTC 2 cut(s) 596, 620
Ama87I CYCGRG 1 cut(s) 266
AoxI GGCC 2 cut(s) 525, 747
ApeKI GCWGC 2 cut(s) 670, 719
AspS9I GGNCC 2 cut(s) 525, 565
AsuC2I CCSGG 1 cut(s) 533
AsuHPI GGTGA 2 cut(s) 85, 835
AsuNHI GCTAGC 1 cut(s) 694
AvaI CYCGRG 1 cut(s) 266
AvaII GGWCC 1 cut(s) 565
BalI TGGCCA 1 cut(s) 749
BanI GGYRCC 1 cut(s) 4
BauI CACGAG 1 cut(s) 69
BbvI GCAGC 2 cut(s) 682, 731
BccI CCATC 1 cut(s) 565
BceAI ACGGC 1 cut(s) 628
BclI TGATCA 1 cut(s) 100
BcnI CCSGG 1 cut(s) 533
BcoDI GTCTC 2 cut(s) 596, 620
BfaI CTAG 4 cut(s) 57, 438, 674, 695
BfmI CTRYAG 1 cut(s) 309
BisI GCNGC 2 cut(s) 671, 720
BlsI GCNGC 2 cut(s) 672, 721
BmcAI AGTACT 1 cut(s) 196
Bme1390I CCNGG 1 cut(s) 533
Bme18I GGWCC 1 cut(s) 565
BmeT110I CYCGRG 1 cut(s) 266
BmgT120I GGNCC 2 cut(s) 525, 565
BmiI GGNNCC 3 cut(s) 6, 526, 567
BmrFI CCNGG 1 cut(s) 533
BmsI GCATC 1 cut(s) 662
BmtI GCTAGC 1 cut(s) 698
BpuEI CTTGAG 1 cut(s) 573
BpuMI CCSGG 1 cut(s) 533
BsaAI YACGTR 1 cut(s) 458
BsaBI GATNNNNATC 1 cut(s) 206
BsaJI CCNNGG 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 506
Bse8I GATNNNNATC 1 cut(s) 206
BseDI CCNNGG 1 cut(s) 139
BseJI GATNNNNATC 1 cut(s) 206
BseMII CTCAG 3 cut(s) 212, 338, 615
BseNI ACTGG 1 cut(s) 506
BseRI GAGGAG 1 cut(s) 819
BseXI GCAGC 2 cut(s) 682, 731
BshFI GGCC 2 cut(s) 527, 749
BshNI GGYRCC 1 cut(s) 4
BsiHKCI CYCGRG 1 cut(s) 266
BsiSI CCGG 1 cut(s) 533
BslFI GGGAC 2 cut(s) 256, 551
BsmAI GTCTC 2 cut(s) 596, 620
BsmFI GGGAC 2 cut(s) 256, 551
BsmI GAATGC 1 cut(s) 473
BsnI GGCC 2 cut(s) 527, 749
BsoBI CYCGRG 1 cut(s) 266
Bsp143I GATC 4 cut(s) 100, 207, 760, 784
Bsp19I CCATGG 1 cut(s) 139
BspACI CCGC 1 cut(s) 162
BspANI GGCC 2 cut(s) 527, 749
BspCNI CTCAG 3 cut(s) 211, 337, 616
BspLI GGNNCC 3 cut(s) 6, 526, 567
BspOI GCTAGC 1 cut(s) 698
BspQI GCTCTTC 1 cut(s) 660
BspT107I GGYRCC 1 cut(s) 4
BsrI ACTGG 1 cut(s) 506
BssECI CCNNGG 1 cut(s) 139
BssMI GATC 4 cut(s) 100, 207, 760, 784
BssNAI GTATAC 1 cut(s) 461
BssSI CACGAG 1 cut(s) 69
BssT1I CCWWGG 1 cut(s) 139
Bst1107I GTATAC 1 cut(s) 461
Bst2BI CACGAG 1 cut(s) 69
Bst4CI ACNGT 1 cut(s) 19
Bst6I CTCTTC 3 cut(s) 544, 660, 680
BstBAI YACGTR 1 cut(s) 458
BstC8I GCNNGC 1 cut(s) 696
BstDEI CTNAG 3 cut(s) 198, 324, 624
BstDSI CCRYGG 1 cut(s) 139
BstKTI GATC 4 cut(s) 103, 210, 763, 787
BstMAI GTCTC 2 cut(s) 596, 620
BstMBI GATC 4 cut(s) 100, 207, 760, 784
BstMWI GCNNNNNNNGC 7 cut(s) 71, 182, 311, 363, 479, 716, 746
BstSCI CCNGG 1 cut(s) 531
BstSFI CTRYAG 1 cut(s) 309
BstV1I GCAGC 2 cut(s) 682, 731
BstZ17I GTATAC 1 cut(s) 461
BsuRI GGCC 2 cut(s) 527, 749
BtgI CCRYGG 1 cut(s) 139
BtsIMutI CAGTG 4 cut(s) 24, 110, 417, 722
Cac8I GCNNGC 1 cut(s) 696
Cfr13I GGNCC 2 cut(s) 525, 565
Csp6I GTAC 2 cut(s) 195, 515
CviAII CATG 3 cut(s) 83, 140, 182
CviQI GTAC 2 cut(s) 195, 515
DdeI CTNAG 3 cut(s) 198, 324, 624
DpnI GATC 4 cut(s) 102, 209, 762, 786
DpnII GATC 4 cut(s) 100, 207, 760, 784
EaeI YGGCCR 1 cut(s) 747
Eam1104I CTCTTC 3 cut(s) 544, 660, 680
EarI CTCTTC 3 cut(s) 544, 660, 680
Eco130I CCWWGG 1 cut(s) 139
Eco47I GGWCC 1 cut(s) 565
Eco57I CTGAAG 1 cut(s) 525
Eco88I CYCGRG 1 cut(s) 266
EcoO109I RGGNCCY 1 cut(s) 525
EcoT14I CCWWGG 1 cut(s) 139
ErhI CCWWGG 1 cut(s) 139
FaeI CATG 3 cut(s) 86, 143, 185
FaqI GGGAC 2 cut(s) 256, 551
FatI CATG 3 cut(s) 82, 139, 181
FbaI TGATCA 1 cut(s) 100
FblI GTMKAC 1 cut(s) 460
Fnu4HI GCNGC 2 cut(s) 671, 720
Fsp4HI GCNGC 2 cut(s) 671, 720
FspBI CTAG 4 cut(s) 57, 438, 674, 695
GluI GCNGC 2 cut(s) 671, 720
HaeIII GGCC 2 cut(s) 527, 749
HapII CCGG 1 cut(s) 533
Hin1II CATG 3 cut(s) 86, 143, 185
HincII GTYRAC 2 cut(s) 418, 581
HindII GTYRAC 2 cut(s) 418, 581
HinfI GANTC 3 cut(s) 269, 536, 548
HpaII CCGG 1 cut(s) 533
HphI GGTGA 2 cut(s) 85, 835
Hpy166II GTNNAC 3 cut(s) 418, 461, 581
Hpy188I TCNGA 5 cut(s) 201, 319, 327, 352, 803
Hpy188III TCNNGA 3 cut(s) 157, 552, 788
Hpy8I GTNNAC 3 cut(s) 418, 461, 581
HpyAV CCTTC 1 cut(s) 538
HpyCH4III ACNGT 1 cut(s) 19
HpyCH4IV ACGT 1 cut(s) 457
HpyF10VI GCNNNNNNNGC 7 cut(s) 71, 182, 311, 363, 479, 716, 746
HpyF3I CTNAG 3 cut(s) 198, 324, 624
HpySE526I ACGT 1 cut(s) 457
Hsp92II CATG 3 cut(s) 86, 143, 185
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 4 cut(s) 100, 207, 760, 784
LguI GCTCTTC 1 cut(s) 660
LmnI GCTCC 1 cut(s) 470
Lsp1109I GCAGC 2 cut(s) 682, 731
LweI GCATC 1 cut(s) 662
MaeI CTAG 4 cut(s) 57, 438, 674, 695
MaeII ACGT 1 cut(s) 457
MaeIII GTNAC 4 cut(s) 13, 235, 643, 823
MalI GATC 4 cut(s) 102, 209, 762, 786
MboI GATC 4 cut(s) 100, 207, 760, 784
MboII GAAGA 4 cut(s) 531, 677, 689, 697
MfeI CAATTG 1 cut(s) 734
MlsI TGGCCA 1 cut(s) 749
MluCI AATT 2 cut(s) 734, 812
MluNI TGGCCA 1 cut(s) 749
MlyI GAGTC 2 cut(s) 278, 530
MnlI CCTC 6 cut(s) 117, 275, 333, 358, 439, 797
Mox20I TGGCCA 1 cut(s) 749
MscI TGGCCA 1 cut(s) 749
MseI TTAA 3 cut(s) 36, 384, 510
MslI CAYNNNNRTG 1 cut(s) 768
Msp20I TGGCCA 1 cut(s) 749
MspI CCGG 1 cut(s) 533
MspR9I CCNGG 1 cut(s) 533
MunI CAATTG 1 cut(s) 734
Mva1269I GAATGC 1 cut(s) 473
MwoI GCNNNNNNNGC 7 cut(s) 71, 182, 311, 363, 479, 716, 746
NciI CCSGG 1 cut(s) 533
NcoI CCATGG 1 cut(s) 139
NdeII GATC 4 cut(s) 100, 207, 760, 784
NheI GCTAGC 1 cut(s) 694
NlaIII CATG 3 cut(s) 86, 143, 185
NlaIV GGNNCC 3 cut(s) 6, 526, 567
NmuCI GTSAC 2 cut(s) 643, 823
PaeR7I CTCGAG 1 cut(s) 266
PciSI GCTCTTC 1 cut(s) 660
PctI GAATGC 1 cut(s) 473
PfeI GAWTC 1 cut(s) 548
PflFI GACNNNGTC 1 cut(s) 631
PfoI TCCNGGA 1 cut(s) 531
PkrI GCNGC 2 cut(s) 672, 721
PleI GAGTC 2 cut(s) 277, 530
PpsI GAGTC 2 cut(s) 277, 530
Ppu21I YACGTR 1 cut(s) 458
PspN4I GGNNCC 3 cut(s) 6, 526, 567
PspPI GGNCC 2 cut(s) 525, 565
PspXI VCTCGAGB 1 cut(s) 266
PsyI GACNNNGTC 1 cut(s) 631
RsaI GTAC 2 cut(s) 196, 516
RsaNI GTAC 2 cut(s) 195, 515
RseI CAYNNNNRTG 1 cut(s) 768
SapI GCTCTTC 1 cut(s) 660
SaqAI TTAA 3 cut(s) 36, 384, 510
SatI GCNGC 2 cut(s) 671, 720
Sau3AI GATC 4 cut(s) 100, 207, 760, 784
Sau96I GGNCC 2 cut(s) 525, 565
ScaI AGTACT 1 cut(s) 196
SchI GAGTC 2 cut(s) 278, 530
ScrFI CCNGG 1 cut(s) 533
SfaNI GCATC 1 cut(s) 662
SfcI CTRYAG 1 cut(s) 309
Sfr274I CTCGAG 1 cut(s) 266
SinI GGWCC 1 cut(s) 565
SlaI CTCGAG 1 cut(s) 266
SmiMI CAYNNNNRTG 1 cut(s) 768
SmlI CTYRAG 2 cut(s) 266, 588
SmoI CTYRAG 2 cut(s) 266, 588
Sse9I AATT 2 cut(s) 734, 812
SsiI CCGC 1 cut(s) 162
SspMI CTAG 4 cut(s) 57, 438, 674, 695
StyD4I CCNGG 1 cut(s) 531
StyI CCWWGG 1 cut(s) 139
TaaI ACNGT 1 cut(s) 19
TaiI ACGT 1 cut(s) 460
TaqI TCGA 3 cut(s) 50, 267, 344
TasI AATT 2 cut(s) 734, 812
TatI WGTACW 1 cut(s) 194
TfiI GAWTC 1 cut(s) 548
Tru1I TTAA 3 cut(s) 36, 384, 510
Tru9I TTAA 3 cut(s) 36, 384, 510
TscAI CASTG 4 cut(s) 24, 117, 417, 729
TseFI GTSAC 2 cut(s) 643, 823
TseI GCWGC 2 cut(s) 670, 719
Tsp45I GTSAC 2 cut(s) 643, 823
TspDTI ATGAA 4 cut(s) 78, 328, 698, 789
TspRI CASTG 4 cut(s) 24, 117, 417, 729
Tth111I GACNNNGTC 1 cut(s) 631
VpaK11BI GGWCC 1 cut(s) 565
XhoI CTCGAG 1 cut(s) 266
XmiI GTMKAC 1 cut(s) 460
XspI CTAG 4 cut(s) 57, 438, 674, 695
ZrmI AGTACT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.