Rw6G012210

Retrotransposon gag protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
OG0000128
Physical Location & Seq
Reverse (-)
22217316 .. 22218559
1244 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G012210.1

Sequence Viewer

Length: 1074 bp
ATGGAGAAGTTAGAAACTCAACGTGGCGATGACTCAGAAAAAGGTCCGCATGGTCATAAGAAAGACTCATCTGGTGGATCACTTTCTAAACAAAAAGAAGAATCAAATTCCATCCTAGCTTCATGGTCAATTCAACAACTTCAAGACATGATTACCAACACAATTAGAGCTCAATATGGTGGTCCCTCTCAGGATACGCTAACGTACTCCAAACCTTATACGAAGCGGCTCGACAATTTGAGGATGCCAACTGGGTACCAACCTCCCAAGTTTCAACAATTCGATGGAAAAGAATCCATTGACAGCTGGGAGCAAATGGAAAAAGAGTTCTTGAATCGTTTCTTCAGTACACGTCACATTGTGAGCATGTTAGAGCTCACCAACACCAAACAACGAAATGACGAGCACCTCGATTGCAAGGACAGACTCTCAGAGTTGTCCGCAGTAGAAATGTGTATTCAAGGCATGCATTGGGACTTACTGTACATCCTTCAAGGGATAAAGCCTCGCACCTTTGAAGAACTTGCCACTCGAGCTCATGACATGGAACTTAGCATCGCTAGTCATGGTCGAAGAAAAGGTGAAATCGTTGAACCACATAATCAGAAACATGTCATGGAGTCTTTGGCGATCATAACTCCTGTCAAGATCACAACACGAATCAAGTCAAATAACCAAAACAAGTTGGAGTCGACTCATGATCAAATAAGGCGGCGCACTCTTAGAGAGCTAGAAGCTAAAAGTTACCCTTTTCCAGATTCCGATGTTGCTGACATGTTGGAAGATTTGCTTCAAAAGAAAATAATCATATTGCCAGACTGCAAACGTCGGGAAGAGATGCATCGCACCAATGAACCAAAGTATTGCAAATACCACCGTGTCATCGGTCACCCGACGGAAAAGTGCTTTGTGTTGAAAGACCTCGTCATGAAGCTTGCACAACAAGGAAGAATCTGTTTAGACTTTGAAGATGACGTGGCCCAATCAAATCATGCTACCATCATCTTTGAACAACTCGAAGCAGTGTCATCGTCGCCTTTGCTGGGGGCATGCTACTTACCCAAATTGTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotrans_gag

Protein Analysis

357

Amino Acids

41.26

Weight (kDa)

6.71

Isoelectric Point (pI)

50.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 255
AccB1I GGYRCC 1 cut(s) 255
AccI GTMKAC 1 cut(s) 692
AciI CCGC 4 cut(s) 47, 226, 441, 712
AclWI GGATC 1 cut(s) 85
AcsI RAATTY 1 cut(s) 106
AcuI CTGAAG 1 cut(s) 328
AdeI CACNNNGTG 1 cut(s) 361
AfaI GTAC 4 cut(s) 206, 257, 349, 485
AfiI CCNNNNNNNGG 1 cut(s) 1043
AflIII ACRYGT 3 cut(s) 350, 610, 774
AjiI CACGTC 2 cut(s) 353, 976
AloI GAACNNNNNNTCC 2 cut(s) 311, 343
AluBI AGCT 8 cut(s) 119, 170, 306, 376, 536, 730, 737, 934
AluI AGCT 8 cut(s) 119, 170, 306, 376, 536, 730, 737, 934
Alw21I GWGCWC 4 cut(s) 172, 378, 408, 538
AlwI GGATC 1 cut(s) 85
Ama87I CYCGRG 1 cut(s) 531
AoxI GGCC 1 cut(s) 978
ApoI RAATTY 1 cut(s) 106
Asp700I GAANNNNTTC 1 cut(s) 338
Asp718I GGTACC 1 cut(s) 255
AspLEI GCGC 1 cut(s) 717
AspS9I GGNCC 3 cut(s) 44, 182, 979
AsuHPI GGTGA 3 cut(s) 370, 593, 881
AvaI CYCGRG 1 cut(s) 531
AvaII GGWCC 2 cut(s) 44, 182
BanI GGYRCC 1 cut(s) 255
BanII GRGCYC 3 cut(s) 172, 378, 538
Bbv12I GWGCWC 4 cut(s) 172, 378, 408, 538
BccI CCATC 3 cut(s) 119, 278, 1007
BcgI CGANNNNNNTGC 2 cut(s) 1011, 1045
BciVI GTATCC 1 cut(s) 187
BclI TGATCA 1 cut(s) 700
BfaI CTAG 3 cut(s) 116, 561, 731
BfuI GTATCC 1 cut(s) 187
BisI GCNGC 2 cut(s) 227, 713
BlsI GCNGC 2 cut(s) 228, 714
Bme18I GGWCC 2 cut(s) 44, 182
BmeT110I CYCGRG 1 cut(s) 531
BmgBI CACGTC 2 cut(s) 353, 976
BmgT120I GGNCC 3 cut(s) 44, 182, 979
BmiI GGNNCC 2 cut(s) 184, 257
BmrI ACTGGG 1 cut(s) 261
BmsI GCATC 4 cut(s) 234, 564, 828, 850
BmuI ACTGGG 1 cut(s) 261
Bsc4I CCNNNNNNNGG 1 cut(s) 1043
Bse1I ACTGG 1 cut(s) 256
BseGI GGATG 3 cut(s) 111, 249, 486
BseLI CCNNNNNNNGG 1 cut(s) 1043
BseMII CTCAG 3 cut(s) 48, 203, 444
BseNI ACTGG 1 cut(s) 256
BseYI CCCAGC 2 cut(s) 306, 1042
BshFI GGCC 1 cut(s) 980
BshNI GGYRCC 1 cut(s) 255
BsiHKAI GWGCWC 4 cut(s) 172, 378, 408, 538
BsiHKCI CYCGRG 1 cut(s) 531
BslFI GGGAC 2 cut(s) 168, 488
BslI CCNNNNNNNGG 1 cut(s) 1043
BsmFI GGGAC 2 cut(s) 168, 488
BsnI GGCC 1 cut(s) 980
BsoBI CYCGRG 1 cut(s) 531
Bsp1286I GDGCHC 4 cut(s) 172, 378, 408, 538
Bsp1407I TGTACA 1 cut(s) 483
Bsp143I GATC 4 cut(s) 77, 630, 648, 700
BspACI CCGC 4 cut(s) 47, 226, 441, 712
BspANI GGCC 1 cut(s) 980
BspCNI CTCAG 3 cut(s) 47, 202, 443
BspHI TCATGA 3 cut(s) 538, 697, 927
BspLI GGNNCC 2 cut(s) 184, 257
BspPI GGATC 1 cut(s) 85
BspT107I GGYRCC 1 cut(s) 255
BsrGI TGTACA 1 cut(s) 483
BsrI ACTGG 1 cut(s) 256
BssMI GATC 4 cut(s) 77, 630, 648, 700
Bst4CI ACNGT 2 cut(s) 483, 878
Bst6I CTCTTC 1 cut(s) 828
BstAUI TGTACA 1 cut(s) 483
BstC8I GCNNGC 3 cut(s) 467, 936, 1051
BstDEI CTNAG 5 cut(s) 34, 189, 430, 551, 722
BstEII GGTNACC 1 cut(s) 887
BstF5I GGATG 3 cut(s) 111, 249, 486
BstHHI GCGC 1 cut(s) 717
BstKTI GATC 4 cut(s) 80, 633, 651, 703
BstMBI GATC 4 cut(s) 77, 630, 648, 700
BstMWI GCNNNNNNNGC 1 cut(s) 533
BstNSI RCATGY 5 cut(s) 370, 469, 614, 778, 1053
BstPI GGTNACC 1 cut(s) 887
BsuI GTATCC 1 cut(s) 187
BsuRI GGCC 1 cut(s) 980
BtgZI GCGATG 3 cut(s) 42, 541, 827
BtrI CACGTC 2 cut(s) 353, 976
BtsCI GGATG 3 cut(s) 111, 249, 486
BtsI GCAGTG 1 cut(s) 1029
BtsIMutI CAGTG 1 cut(s) 1029
Cac8I GCNNGC 3 cut(s) 467, 936, 1051
CciI TCATGA 3 cut(s) 538, 697, 927
CfoI GCGC 1 cut(s) 717
Cfr13I GGNCC 3 cut(s) 44, 182, 979
Csp6I GTAC 4 cut(s) 205, 256, 348, 484
CviQI GTAC 4 cut(s) 205, 256, 348, 484
DdeI CTNAG 5 cut(s) 34, 189, 430, 551, 722
DpnI GATC 4 cut(s) 79, 632, 650, 702
DpnII GATC 4 cut(s) 77, 630, 648, 700
DraIII CACNNNGTG 1 cut(s) 361
Eam1104I CTCTTC 1 cut(s) 828
EarI CTCTTC 1 cut(s) 828
Ecl136II GAGCTC 3 cut(s) 170, 376, 536
Eco24I GRGCYC 3 cut(s) 172, 378, 538
Eco47I GGWCC 2 cut(s) 44, 182
Eco53kI GAGCTC 3 cut(s) 170, 376, 536
Eco57I CTGAAG 1 cut(s) 328
Eco88I CYCGRG 1 cut(s) 531
Eco91I GGTNACC 1 cut(s) 887
EcoICRI GAGCTC 3 cut(s) 170, 376, 536
EcoO65I GGTNACC 1 cut(s) 887
EcoT22I ATGCAT 2 cut(s) 471, 843
EcoT38I GRGCYC 3 cut(s) 172, 378, 538
FalI AAGNNNNNCTT 4 cut(s) 733, 765, 774, 806
FaqI GGGAC 2 cut(s) 168, 488
FbaI TGATCA 1 cut(s) 700
FblI GTMKAC 1 cut(s) 692
Fnu4HI GCNGC 2 cut(s) 227, 713
FokI GGATG 3 cut(s) 98, 256, 473
FriOI GRGCYC 3 cut(s) 172, 378, 538
Fsp4HI GCNGC 2 cut(s) 227, 713
FspBI CTAG 3 cut(s) 116, 561, 731
GlaI GCGC 1 cut(s) 716
GluI GCNGC 2 cut(s) 227, 713
GsaI CCCAGC 2 cut(s) 310, 1046
HaeIII GGCC 1 cut(s) 980
HhaI GCGC 1 cut(s) 717
Hin6I GCGC 1 cut(s) 715
HinP1I GCGC 1 cut(s) 715
HincII GTYRAC 1 cut(s) 693
HindII GTYRAC 1 cut(s) 693
HindIII AAGCTT 1 cut(s) 932
HphI GGTGA 3 cut(s) 370, 593, 881
Hpy166II GTNNAC 2 cut(s) 350, 693
Hpy188I TCNGA 4 cut(s) 37, 433, 606, 763
Hpy188III TCNNGA 9 cut(s) 143, 191, 331, 539, 646, 698, 755, 830, 928
Hpy8I GTNNAC 2 cut(s) 350, 693
Hpy99I CGWCG 3 cut(s) 831, 898, 1036
HpyAV CCTTC 1 cut(s) 500
HpyCH4III ACNGT 2 cut(s) 483, 878
HpyCH4IV ACGT 5 cut(s) 22, 203, 352, 826, 975
HpyCH4V TGCA 6 cut(s) 417, 469, 822, 841, 867, 938
HpyF10VI GCNNNNNNNGC 1 cut(s) 533
HpyF3I CTNAG 5 cut(s) 34, 189, 430, 551, 722
HpySE526I ACGT 5 cut(s) 22, 203, 352, 826, 975
HspAI GCGC 1 cut(s) 715
KpnI GGTACC 1 cut(s) 259
Ksp22I TGATCA 1 cut(s) 700
Kzo9I GATC 4 cut(s) 77, 630, 648, 700
LmnI GCTCC 1 cut(s) 310
LpnPI CCDG 8 cut(s) 57, 176, 237, 292, 654, 768, 828, 1028
LweI GCATC 4 cut(s) 234, 564, 828, 850
MaeI CTAG 3 cut(s) 116, 561, 731
MaeII ACGT 5 cut(s) 22, 203, 352, 826, 975
MaeIII GTNAC 3 cut(s) 353, 743, 887
MalI GATC 4 cut(s) 79, 632, 650, 702
MboI GATC 4 cut(s) 77, 630, 648, 700
MboII GAAGA 8 cut(s) 110, 334, 530, 585, 794, 845, 960, 980
MhlI GDGCHC 4 cut(s) 172, 378, 408, 538
MluCI AATT 6 cut(s) 106, 129, 162, 235, 278, 1064
MlyI GAGTC 6 cut(s) 26, 59, 420, 629, 688, 698
MmeI TCCRAC 2 cut(s) 666, 759
MnlI CCTC 6 cut(s) 196, 234, 273, 419, 516, 932
Mph1103I ATGCAT 2 cut(s) 471, 843
MroXI GAANNNNTTC 1 cut(s) 338
MseI TTAA 1 cut(s) 1072
MspA1I CMGCKG 1 cut(s) 306
MwoI GCNNNNNNNGC 1 cut(s) 533
NdeII GATC 4 cut(s) 77, 630, 648, 700
NlaIV GGNNCC 2 cut(s) 184, 257
NmuCI GTSAC 2 cut(s) 353, 887
NsiI ATGCAT 2 cut(s) 471, 843
NspI RCATGY 5 cut(s) 370, 469, 614, 778, 1053
PaeI GCATGC 2 cut(s) 469, 1053
PaeR7I CTCGAG 1 cut(s) 531
PagI TCATGA 3 cut(s) 538, 697, 927
PciI ACATGT 2 cut(s) 610, 774
PcsI WCGNNNNNNNCGW 1 cut(s) 408
PdmI GAANNNNTTC 1 cut(s) 338
PfeI GAWTC 6 cut(s) 101, 293, 334, 660, 758, 951
PflFI GACNNNGTC 1 cut(s) 923
PkrI GCNGC 2 cut(s) 228, 714
PleI GAGTC 6 cut(s) 26, 59, 420, 628, 688, 697
PpsI GAGTC 6 cut(s) 26, 59, 420, 628, 688, 697
PscI ACATGT 2 cut(s) 610, 774
Psp124BI GAGCTC 3 cut(s) 172, 378, 538
PspEI GGTNACC 1 cut(s) 887
PspFI CCCAGC 2 cut(s) 306, 1042
PspN4I GGNNCC 2 cut(s) 184, 257
PspPI GGNCC 3 cut(s) 44, 182, 979
PspXI VCTCGAGB 1 cut(s) 531
PsyI GACNNNGTC 1 cut(s) 923
PvuII CAGCTG 1 cut(s) 306
RsaI GTAC 4 cut(s) 206, 257, 349, 485
RsaNI GTAC 4 cut(s) 205, 256, 348, 484
SacI GAGCTC 3 cut(s) 172, 378, 538
SalI GTCGAC 1 cut(s) 691
SaqAI TTAA 1 cut(s) 1072
SatI GCNGC 2 cut(s) 227, 713
Sau3AI GATC 4 cut(s) 77, 630, 648, 700
Sau96I GGNCC 3 cut(s) 44, 182, 979
SchI GAGTC 6 cut(s) 26, 59, 420, 629, 688, 698
SduI GDGCHC 4 cut(s) 172, 378, 408, 538
SfaNI GCATC 4 cut(s) 234, 564, 828, 850
Sfr274I CTCGAG 1 cut(s) 531
SinI GGWCC 2 cut(s) 44, 182
SlaI CTCGAG 1 cut(s) 531
SmlI CTYRAG 1 cut(s) 531
SmoI CTYRAG 1 cut(s) 531
SphI GCATGC 2 cut(s) 469, 1053
Sse9I AATT 6 cut(s) 106, 129, 162, 235, 278, 1064
SsiI CCGC 4 cut(s) 47, 226, 441, 712
SspMI CTAG 3 cut(s) 116, 561, 731
SstI GAGCTC 3 cut(s) 172, 378, 538
TaaI ACNGT 2 cut(s) 483, 878
TaiI ACGT 5 cut(s) 25, 206, 355, 829, 978
TaqI TCGA 7 cut(s) 231, 282, 411, 532, 571, 692, 1017
TaqII GACCGA 1 cut(s) 875
TasI AATT 6 cut(s) 106, 129, 162, 235, 278, 1064
TatI WGTACW 2 cut(s) 347, 483
TauI GCSGC 2 cut(s) 229, 715
TfiI GAWTC 6 cut(s) 101, 293, 334, 660, 758, 951
Tru1I TTAA 1 cut(s) 1072
Tru9I TTAA 1 cut(s) 1072
TscAI CASTG 1 cut(s) 1029
TseFI GTSAC 2 cut(s) 353, 887
Tsp45I GTSAC 2 cut(s) 353, 887
TspDTI ATGAA 3 cut(s) 111, 867, 944
TspGWI ACGGA 1 cut(s) 911
TspRI CASTG 1 cut(s) 1029
Tth111I GACNNNGTC 1 cut(s) 923
VpaK11BI GGWCC 2 cut(s) 44, 182
XapI RAATTY 1 cut(s) 106
XceI RCATGY 5 cut(s) 370, 469, 614, 778, 1053
XhoI CTCGAG 1 cut(s) 531
XmiI GTMKAC 1 cut(s) 692
XmnI GAANNNNTTC 1 cut(s) 338
XspI CTAG 3 cut(s) 116, 561, 731
Zsp2I ATGCAT 2 cut(s) 471, 843
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.