Rmu_sc0015793.1_g000001

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015793.1
OG0000128
Physical Location & Seq
Forward (+)
176 .. 571
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015793.1_g000001.1.cds

Sequence Viewer

Length: 396 bp
atgcactttgattcgccatacatcctacagggaatcaagccccgtacctttgaagagctggctacgcgagcacatgacatggagttgagtatagctagccataaggggaagaaaaagtcaattgttgaccaaaggaaagacaaggtcttcagaagcaagtttgacaaggcaccgaagaaatctgcaaaagaatcaatgaccgttaacattgccccagtcaaaatctcgacacgagataaggaggttaagaaagctgagccaactcgcacctacgacagaacaaagcgttcgttgaaggaatggcaacaaaagacatatcctttcccagattctgacgtggcaggcatgttggaagatctacttgagaagaaggtgatagagctcccaaaatgctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 Retrotrans_gag

Protein Analysis

131

Amino Acids

15.19

Weight (kDa)

9.68

Isoelectric Point (pI)

50.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 169
AccII CGCG 1 cut(s) 67
AcuI CTGAAG 1 cut(s) 133
AfaI GTAC 1 cut(s) 46
AgsI TTSAA 2 cut(s) 53, 295
AjiI CACGTC 1 cut(s) 337
AluBI AGCT 4 cut(s) 58, 95, 254, 382
AluI AGCT 4 cut(s) 58, 95, 254, 382
Alw21I GWGCWC 2 cut(s) 73, 384
AlwNI CAGNNNCTG 1 cut(s) 332
AsuHPI GGTGA 1 cut(s) 385
AsuNHI GCTAGC 1 cut(s) 95
BanI GGYRCC 1 cut(s) 169
BanII GRGCYC 1 cut(s) 384
BauI CACGAG 1 cut(s) 231
BbsI GAAGAC 1 cut(s) 139
Bbv12I GWGCWC 2 cut(s) 73, 384
BfaI CTAG 2 cut(s) 96, 394
BfmI CTRYAG 1 cut(s) 26
BglII AGATCT 1 cut(s) 355
BlpI GCTNAGC 1 cut(s) 255
BmgBI CACGTC 1 cut(s) 337
BmiI GGNNCC 1 cut(s) 171
BmrI ACTGGG 1 cut(s) 209
BmtI GCTAGC 1 cut(s) 99
BmuI ACTGGG 1 cut(s) 209
BpiI GAAGAC 1 cut(s) 139
Bpu1102I GCTNAGC 1 cut(s) 255
BpuEI CTTGAG 1 cut(s) 383
Bse1I ACTGG 1 cut(s) 215
Bse3DI GCAATG 1 cut(s) 207
BseGI GGATG 1 cut(s) 21
BseMI GCAATG 1 cut(s) 207
BseMII CTCAG 1 cut(s) 246
BseNI ACTGG 1 cut(s) 215
Bsh1236I CGCG 1 cut(s) 67
BshNI GGYRCC 1 cut(s) 169
BsiHKAI GWGCWC 2 cut(s) 73, 384
Bsp1286I GDGCHC 2 cut(s) 73, 384
Bsp143I GATC 1 cut(s) 355
Bsp1720I GCTNAGC 1 cut(s) 255
BspCNI CTCAG 1 cut(s) 247
BspFNI CGCG 1 cut(s) 67
BspLI GGNNCC 1 cut(s) 171
BspOI GCTAGC 1 cut(s) 99
BspQI GCTCTTC 1 cut(s) 48
BspT107I GGYRCC 1 cut(s) 169
BsrDI GCAATG 1 cut(s) 207
BsrI ACTGG 1 cut(s) 215
BssMI GATC 1 cut(s) 355
BssSI CACGAG 1 cut(s) 231
Bst2BI CACGAG 1 cut(s) 231
Bst4CI ACNGT 1 cut(s) 202
Bst6I CTCTTC 1 cut(s) 48
BstC8I GCNNGC 4 cut(s) 60, 69, 97, 343
BstDEI CTNAG 1 cut(s) 255
BstF5I GGATG 1 cut(s) 21
BstFNI CGCG 1 cut(s) 67
BstKTI GATC 1 cut(s) 358
BstMBI GATC 1 cut(s) 355
BstMWI GCNNNNNNNGC 2 cut(s) 64, 68
BstNSI RCATGY 1 cut(s) 349
BstSFI CTRYAG 1 cut(s) 26
BstUI CGCG 1 cut(s) 67
BstV2I GAAGAC 1 cut(s) 139
BstX2I RGATCY 1 cut(s) 355
BstYI RGATCY 1 cut(s) 355
BtrI CACGTC 1 cut(s) 337
BtsCI GGATG 1 cut(s) 21
Cac8I GCNNGC 4 cut(s) 60, 69, 97, 343
CaiI CAGNNNCTG 1 cut(s) 332
Csp6I GTAC 1 cut(s) 45
CviAII CATG 3 cut(s) 74, 79, 346
CviJI RGCY 8 cut(s) 40, 58, 62, 95, 99, 254, 259, 382
CviKI_1 RGCY 8 cut(s) 40, 58, 62, 95, 99, 254, 259, 382
CviQI GTAC 1 cut(s) 45
DdeI CTNAG 1 cut(s) 255
DpnI GATC 1 cut(s) 357
DpnII GATC 1 cut(s) 355
Eam1104I CTCTTC 1 cut(s) 48
EarI CTCTTC 1 cut(s) 48
Ecl136II GAGCTC 1 cut(s) 382
Eco24I GRGCYC 1 cut(s) 384
Eco53kI GAGCTC 1 cut(s) 382
Eco57I CTGAAG 1 cut(s) 133
EcoICRI GAGCTC 1 cut(s) 382
EcoT38I GRGCYC 1 cut(s) 384
FaeI CATG 3 cut(s) 77, 82, 349
FaiI YATR 7 cut(s) 19, 75, 80, 92, 102, 316, 347
FalI AAGNNNNNCTT 2 cut(s) 345, 377
FatI CATG 3 cut(s) 73, 78, 345
FokI GGATG 1 cut(s) 8
FriOI GRGCYC 1 cut(s) 384
FspBI CTAG 2 cut(s) 96, 394
Hin1II CATG 3 cut(s) 77, 82, 349
HincII GTYRAC 2 cut(s) 127, 205
HindII GTYRAC 2 cut(s) 127, 205
HinfI GANTC 4 cut(s) 11, 33, 191, 329
HpaI GTTAAC 1 cut(s) 205
HphI GGTGA 1 cut(s) 385
Hpy166II GTNNAC 2 cut(s) 127, 205
Hpy188I TCNGA 2 cut(s) 152, 334
Hpy188III TCNNGA 1 cut(s) 226
Hpy8I GTNNAC 2 cut(s) 127, 205
HpyAV CCTTC 2 cut(s) 289, 364
HpyCH4III ACNGT 1 cut(s) 202
HpyCH4IV ACGT 1 cut(s) 336
HpyCH4V TGCA 2 cut(s) 4, 185
HpyF10VI GCNNNNNNNGC 2 cut(s) 64, 68
HpyF3I CTNAG 1 cut(s) 255
HpySE526I ACGT 1 cut(s) 336
Hsp92II CATG 3 cut(s) 77, 82, 349
KspAI GTTAAC 1 cut(s) 205
Kzo9I GATC 1 cut(s) 355
LguI GCTCTTC 1 cut(s) 48
LmnI GCTCC 1 cut(s) 387
LpnPI CCDG 5 cut(s) 14, 44, 228, 327, 339
MaeI CTAG 2 cut(s) 96, 394
MaeII ACGT 1 cut(s) 336
MalI GATC 1 cut(s) 357
MboI GATC 1 cut(s) 355
MboII GAAGA 6 cut(s) 65, 121, 139, 187, 365, 379
MfeI CAATTG 1 cut(s) 120
MflI RGATCY 1 cut(s) 355
MhlI GDGCHC 2 cut(s) 73, 384
MluCI AATT 1 cut(s) 120
MmeI TCCRAC 1 cut(s) 330
MnlI CCTC 1 cut(s) 235
MseI TTAA 2 cut(s) 204, 246
MunI CAATTG 1 cut(s) 120
MvnI CGCG 1 cut(s) 67
MwoI GCNNNNNNNGC 2 cut(s) 64, 68
NdeII GATC 1 cut(s) 355
NheI GCTAGC 1 cut(s) 95
NlaIII CATG 3 cut(s) 77, 82, 349
NlaIV GGNNCC 1 cut(s) 171
NspI RCATGY 1 cut(s) 349
PciSI GCTCTTC 1 cut(s) 48
PfeI GAWTC 4 cut(s) 11, 33, 191, 329
PflFI GACNNNGTC 1 cut(s) 143
Psp124BI GAGCTC 1 cut(s) 384
PspN4I GGNNCC 1 cut(s) 171
PstNI CAGNNNCTG 1 cut(s) 332
PsuI RGATCY 1 cut(s) 355
PsyI GACNNNGTC 1 cut(s) 143
RsaI GTAC 1 cut(s) 46
RsaNI GTAC 1 cut(s) 45
SacI GAGCTC 1 cut(s) 384
SapI GCTCTTC 1 cut(s) 48
SaqAI TTAA 2 cut(s) 204, 246
Sau3AI GATC 1 cut(s) 355
SduI GDGCHC 2 cut(s) 73, 384
SfcI CTRYAG 1 cut(s) 26
SmlI CTYRAG 1 cut(s) 362
SmoI CTYRAG 1 cut(s) 362
Sse9I AATT 1 cut(s) 120
SspMI CTAG 2 cut(s) 96, 394
SstI GAGCTC 1 cut(s) 384
TaaI ACNGT 1 cut(s) 202
TaiI ACGT 1 cut(s) 339
TaqI TCGA 1 cut(s) 227
TasI AATT 1 cut(s) 120
TfiI GAWTC 4 cut(s) 11, 33, 191, 329
Tru1I TTAA 2 cut(s) 204, 246
Tru9I TTAA 2 cut(s) 204, 246
Tth111I GACNNNGTC 1 cut(s) 143
XceI RCATGY 1 cut(s) 349
XspI CTAG 2 cut(s) 96, 394
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.