Rmu_ssc0000259.1_g000057

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000259.1
OG0000128
Physical Location & Seq
Forward (+)
249644 .. 250624
981 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000259.1_g000057.1.cds

Sequence Viewer

Length: 846 bp
atggatgatggaacagtaaaggaagttctcccagtgggagtaccttctacagggaaaactgcagaagtgcttaataaggaggtggaatccagcatggcaagaaatcacaatgaggaaccgtataaagtttcttcggaaattaatgtggcagcttcaaagaacaaaatcagctcctctgctccagttcttcgttacgtgccaaggtctaggcgaaaagaaggggagtctccttttgtggaggcaaatgagcaagaacagcatgggacacttcctgacaaaaggacaaaggaaggatttgaccctaacgcttacaagctgctagcaaaggctggatatgactttggttcgtcaagcatggaaggtggccaagtcatccctggtaaaaaggtgcatgagcttaatgaatctcaaaggaggttgagagagcaaggatgcacagctgaccctgctaaagcaggtcttggttttataccaggtaaaccaatcaaaatttcaggaagaagaaaagttgtgaaggcaagcacacaacacattagtgttgaagtaatagaagaagagactcaagaatctgaatctgtttctcgcgtttcgggatttgaacgcattcatcctaattctcaagctgcggtgcctgaacaagtggatgaattggtgcctcgagtttctgtgtttgatcttgtcgacacatcaacaagccgaatctcagttttcaatcgcatcacccaaacaaccactcgagcttccttgttcagtaggttgtcatcttctgatgaaggaaataagaaatctgagttagcccctcaaaagtcagcacttgagaggatacaagcacccaaagagcaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 rve

Protein Analysis

281

Amino Acids

30.8

Weight (kDa)

7.8

Isoelectric Point (pI)

57.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 446
AccB1I GGYRCC 2 cut(s) 628, 652
AccI GTMKAC 1 cut(s) 681
AccII CGCG 1 cut(s) 585
AciI CCGC 1 cut(s) 626
AcoI YGGCCR 1 cut(s) 364
AcsI RAATTY 1 cut(s) 489
AfaI GTAC 1 cut(s) 42
AfiI CCNNNNNNNGG 1 cut(s) 50
AgsI TTSAA 4 cut(s) 156, 542, 599, 712
AjnI CCWGG 2 cut(s) 376, 472
AjuI GAANNNNNNNTTGG 2 cut(s) 475, 507
AleI CACNNNNGTG 1 cut(s) 534
AluBI AGCT 7 cut(s) 152, 171, 316, 397, 440, 623, 740
AluI AGCT 7 cut(s) 152, 171, 316, 397, 440, 623, 740
Alw26I GTCTC 2 cut(s) 231, 551
Ama87I CYCGRG 2 cut(s) 657, 735
AoxI GGCC 1 cut(s) 364
ApeKI GCWGC 3 cut(s) 149, 316, 623
ApoI RAATTY 1 cut(s) 489
AseI ATTAAT 1 cut(s) 141
Asp700I GAANNNNTTC 1 cut(s) 603
AsuHPI GGTGA 1 cut(s) 712
AsuNHI GCTAGC 1 cut(s) 319
AvaI CYCGRG 2 cut(s) 657, 735
BalI TGGCCA 1 cut(s) 366
BanI GGYRCC 2 cut(s) 628, 652
BbvI GCAGC 3 cut(s) 161, 303, 610
BccI CCATC 1 cut(s) 2
BciT130I CCWGG 2 cut(s) 378, 474
BciVI GTATCC 1 cut(s) 816
BcoDI GTCTC 2 cut(s) 231, 551
BfaI CTAG 2 cut(s) 207, 320
BfmI CTRYAG 2 cut(s) 48, 60
BfuAI ACCTGC 1 cut(s) 446
BfuI GTATCC 1 cut(s) 816
BisI GCNGC 3 cut(s) 150, 317, 624
BlsI GCNGC 3 cut(s) 151, 318, 625
Bme1390I CCNGG 2 cut(s) 378, 474
BmeT110I CYCGRG 2 cut(s) 657, 735
BmiI GGNNCC 3 cut(s) 117, 630, 654
BmrFI CCNGG 2 cut(s) 378, 474
BmrI ACTGGG 1 cut(s) 26
BmsI GCATC 2 cut(s) 422, 726
BmtI GCTAGC 1 cut(s) 323
BmuI ACTGGG 1 cut(s) 26
BpmI CTGGAG 1 cut(s) 165
BpuEI CTTGAG 3 cut(s) 546, 603, 836
BsaAI YACGTR 1 cut(s) 196
BsaJI CCNNGG 2 cut(s) 200, 376
Bsc4I CCNNNNNNNGG 1 cut(s) 50
Bse1I ACTGG 2 cut(s) 32, 182
BseBI CCWGG 2 cut(s) 378, 474
BseDI CCNNGG 2 cut(s) 200, 376
BseGI GGATG 5 cut(s) 10, 372, 437, 607, 649
BseLI CCNNNNNNNGG 1 cut(s) 50
BseMII CTCAG 2 cut(s) 717, 780
BseNI ACTGG 2 cut(s) 32, 182
BseRI GAGGAG 1 cut(s) 163
BseXI GCAGC 3 cut(s) 161, 303, 610
Bsh1236I CGCG 1 cut(s) 585
BshFI GGCC 1 cut(s) 366
BshNI GGYRCC 2 cut(s) 628, 652
BsiHKCI CYCGRG 2 cut(s) 657, 735
BslFI GGGAC 1 cut(s) 277
BslI CCNNNNNNNGG 1 cut(s) 50
BsmAI GTCTC 2 cut(s) 231, 551
BsmFI GGGAC 1 cut(s) 277
BsmI GAATGC 1 cut(s) 603
BsnI GGCC 1 cut(s) 366
BsoBI CYCGRG 2 cut(s) 657, 735
Bsp143I GATC 1 cut(s) 673
BspACI CCGC 1 cut(s) 626
BspANI GGCC 1 cut(s) 366
BspCNI CTCAG 2 cut(s) 716, 781
BspFNI CGCG 1 cut(s) 585
BspLI GGNNCC 3 cut(s) 117, 630, 654
BspMAI CTGCAG 1 cut(s) 64
BspMI ACCTGC 1 cut(s) 446
BspOI GCTAGC 1 cut(s) 323
BspT107I GGYRCC 2 cut(s) 628, 652
BsrI ACTGG 2 cut(s) 32, 182
BssECI CCNNGG 2 cut(s) 200, 376
BssMI GATC 1 cut(s) 673
BssT1I CCWWGG 1 cut(s) 200
Bst2UI CCWGG 2 cut(s) 378, 474
Bst4CI ACNGT 2 cut(s) 16, 120
Bst6I CTCTTC 1 cut(s) 549
BstBAI YACGTR 1 cut(s) 196
BstC8I GCNNGC 2 cut(s) 321, 520
BstDEI CTNAG 2 cut(s) 703, 789
BstENI CCTNNNNNAGG 1 cut(s) 48
BstF5I GGATG 5 cut(s) 10, 372, 437, 607, 649
BstFNI CGCG 1 cut(s) 585
BstKTI GATC 1 cut(s) 676
BstMAI GTCTC 2 cut(s) 231, 551
BstMBI GATC 1 cut(s) 673
BstMWI GCNNNNNNNGC 2 cut(s) 256, 446
BstNI CCWGG 2 cut(s) 378, 474
BstSCI CCNGG 2 cut(s) 376, 472
BstSFI CTRYAG 2 cut(s) 48, 60
BstUI CGCG 1 cut(s) 585
BstV1I GCAGC 3 cut(s) 161, 303, 610
BsuI GTATCC 1 cut(s) 816
BsuRI GGCC 1 cut(s) 366
BtsCI GGATG 5 cut(s) 10, 372, 437, 607, 649
BtsIMutI CAGTG 1 cut(s) 39
BveI ACCTGC 1 cut(s) 446
Cac8I GCNNGC 2 cut(s) 321, 520
CsiI ACCWGGT 1 cut(s) 472
Csp6I GTAC 1 cut(s) 41
CviAII CATG 4 cut(s) 94, 260, 355, 392
CviQI GTAC 1 cut(s) 41
DdeI CTNAG 2 cut(s) 703, 789
DpnI GATC 1 cut(s) 675
DpnII GATC 1 cut(s) 673
EaeI YGGCCR 1 cut(s) 364
Eam1104I CTCTTC 1 cut(s) 549
EarI CTCTTC 1 cut(s) 549
Eco130I CCWWGG 1 cut(s) 200
Eco88I CYCGRG 2 cut(s) 657, 735
EcoNI CCTNNNNNAGG 1 cut(s) 48
EcoRII CCWGG 2 cut(s) 376, 472
EcoT14I CCWWGG 1 cut(s) 200
ErhI CCWWGG 1 cut(s) 200
FaeI CATG 4 cut(s) 97, 263, 358, 395
FaiI YATR 7 cut(s) 95, 123, 261, 336, 356, 393, 470
FalI AAGNNNNNCTT 2 cut(s) 444, 476
FaqI GGGAC 1 cut(s) 277
FatI CATG 4 cut(s) 93, 259, 354, 391
FblI GTMKAC 1 cut(s) 681
Fnu4HI GCNGC 3 cut(s) 150, 317, 624
FokI GGATG 5 cut(s) 17, 359, 444, 594, 656
Fsp4HI GCNGC 3 cut(s) 150, 317, 624
FspBI CTAG 2 cut(s) 207, 320
GluI GCNGC 3 cut(s) 150, 317, 624
GsuI CTGGAG 1 cut(s) 165
HaeIII GGCC 1 cut(s) 366
Hin1II CATG 4 cut(s) 97, 263, 358, 395
HincII GTYRAC 1 cut(s) 682
HindII GTYRAC 1 cut(s) 682
HinfI GANTC 7 cut(s) 86, 224, 404, 559, 566, 572, 699
HphI GGTGA 1 cut(s) 712
Hpy166II GTNNAC 2 cut(s) 479, 682
Hpy188I TCNGA 4 cut(s) 136, 571, 769, 790
Hpy188III TCNNGA 4 cut(s) 272, 495, 563, 591
Hpy8I GTNNAC 2 cut(s) 479, 682
HpyAV CCTTC 6 cut(s) 54, 212, 284, 353, 508, 767
HpyCH4III ACNGT 2 cut(s) 16, 120
HpyCH4IV ACGT 1 cut(s) 195
HpyCH4V TGCA 3 cut(s) 62, 391, 435
HpyF10VI GCNNNNNNNGC 2 cut(s) 256, 446
HpyF3I CTNAG 2 cut(s) 703, 789
HpySE526I ACGT 1 cut(s) 195
Hsp92II CATG 4 cut(s) 97, 263, 358, 395
Kzo9I GATC 1 cut(s) 673
LmnI GCTCC 2 cut(s) 176, 184
Lsp1109I GCAGC 3 cut(s) 161, 303, 610
LweI GCATC 2 cut(s) 422, 726
MabI ACCWGGT 1 cut(s) 472
MaeI CTAG 2 cut(s) 207, 320
MaeII ACGT 1 cut(s) 195
MaeIII GTNAC 1 cut(s) 191
MalI GATC 1 cut(s) 675
MboI GATC 1 cut(s) 673
MboII GAAGA 7 cut(s) 123, 179, 510, 513, 563, 566, 756
MlsI TGGCCA 1 cut(s) 366
MluCI AATT 4 cut(s) 138, 489, 613, 647
MluNI TGGCCA 1 cut(s) 366
MlyI GAGTC 2 cut(s) 233, 553
MnlI CCTC 8 cut(s) 73, 106, 184, 232, 408, 666, 810, 813
Mox20I TGGCCA 1 cut(s) 366
MroXI GAANNNNTTC 1 cut(s) 603
MscI TGGCCA 1 cut(s) 366
MseI TTAA 3 cut(s) 72, 141, 399
MslI CAYNNNNRTG 1 cut(s) 534
Msp20I TGGCCA 1 cut(s) 366
MspA1I CMGCKG 1 cut(s) 440
MspR9I CCNGG 2 cut(s) 378, 474
Mva1269I GAATGC 1 cut(s) 603
MvaI CCWGG 2 cut(s) 378, 474
MvnI CGCG 1 cut(s) 585
MwoI GCNNNNNNNGC 2 cut(s) 256, 446
NdeII GATC 1 cut(s) 673
NheI GCTAGC 1 cut(s) 319
NlaIII CATG 4 cut(s) 97, 263, 358, 395
NlaIV GGNNCC 3 cut(s) 117, 630, 654
OliI CACNNNNGTG 1 cut(s) 534
PaeR7I CTCGAG 2 cut(s) 657, 735
PctI GAATGC 1 cut(s) 603
PdmI GAANNNNTTC 1 cut(s) 603
PfeI GAWTC 5 cut(s) 86, 404, 566, 572, 699
PkrI GCNGC 3 cut(s) 151, 318, 625
PleI GAGTC 2 cut(s) 232, 553
PpsI GAGTC 2 cut(s) 232, 553
Ppu21I YACGTR 1 cut(s) 196
PshBI ATTAAT 1 cut(s) 141
Psp6I CCWGG 2 cut(s) 376, 472
PspGI CCWGG 2 cut(s) 376, 472
PspN4I GGNNCC 3 cut(s) 117, 630, 654
PspXI VCTCGAGB 2 cut(s) 657, 735
PsrI GAACNNNNNNTAC 2 cut(s) 9, 41
PstI CTGCAG 1 cut(s) 64
PvuII CAGCTG 1 cut(s) 440
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
RseI CAYNNNNRTG 1 cut(s) 534
SalI GTCGAC 1 cut(s) 680
SaqAI TTAA 3 cut(s) 72, 141, 399
SatI GCNGC 3 cut(s) 150, 317, 624
Sau3AI GATC 1 cut(s) 673
SchI GAGTC 2 cut(s) 233, 553
ScrFI CCNGG 2 cut(s) 378, 474
SexAI ACCWGGT 1 cut(s) 472
SfaNI GCATC 2 cut(s) 422, 726
SfcI CTRYAG 2 cut(s) 48, 60
Sfr274I CTCGAG 2 cut(s) 657, 735
SlaI CTCGAG 2 cut(s) 657, 735
SmiMI CAYNNNNRTG 1 cut(s) 534
SmlI CTYRAG 5 cut(s) 561, 618, 657, 735, 815
SmoI CTYRAG 5 cut(s) 561, 618, 657, 735, 815
Sse9I AATT 4 cut(s) 138, 489, 613, 647
SsiI CCGC 1 cut(s) 626
SspMI CTAG 2 cut(s) 207, 320
StyD4I CCNGG 2 cut(s) 376, 472
StyI CCWWGG 1 cut(s) 200
TaaI ACNGT 2 cut(s) 16, 120
TaiI ACGT 1 cut(s) 198
TaqI TCGA 3 cut(s) 658, 681, 736
TasI AATT 4 cut(s) 138, 489, 613, 647
TfiI GAWTC 5 cut(s) 86, 404, 566, 572, 699
Tru1I TTAA 3 cut(s) 72, 141, 399
Tru9I TTAA 3 cut(s) 72, 141, 399
TscAI CASTG 1 cut(s) 39
TseI GCWGC 3 cut(s) 149, 316, 623
TspDTI ATGAA 4 cut(s) 417, 596, 660, 786
TspRI CASTG 1 cut(s) 39
VspI ATTAAT 1 cut(s) 141
XagI CCTNNNNNAGG 1 cut(s) 48
XapI RAATTY 1 cut(s) 489
XcmI CCANNNNNNNNNTGG 1 cut(s) 374
XhoI CTCGAG 2 cut(s) 657, 735
XmiI GTMKAC 1 cut(s) 681
XmnI GAANNNNTTC 1 cut(s) 603
XspI CTAG 2 cut(s) 207, 320
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.