Rmu_sc0007108.1_g000012

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007108.1
OG0000128
Physical Location & Seq
Reverse (-)
46340 .. 47071
732 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007108.1_g000012.1.cds

Sequence Viewer

Length: 615 bp
atggcaccacaagttacagtatatttccaagagcttaaagctattgggtcgaaagctggacaagcaacacgagctaaacatcatgtctcattcaccattgatcaagttccactgacaagcagtgtccagaagctcaaccatgatgtcagagtcattaagaccgctacgctcaatgctaaccatgcccctgttagtactcagataatgatcgggtctattccaatcagtttggtcgttacaccacatagacccgaagccccgtgcctcgagtccccacaacaagtacatctacaatcagcgacaactactatagcttctaaacctcagatagtcaagttcatctcaatctctgacagctcatttggcacacacgacaaaggggcatttccaactaacgtaccacaggggaccttcccagactcttcagcagaatcaagaccatctatggtccctgttgctagtcaagatactcaagcaacgttcgagaatgagggcacaatgcctgagacgatgtcagttatggtcacaaacgcatcaataatagaagagcagctagaagaaatgaagagaatgctagctgaaaaagatgctcaaatagcagcactgacttcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

204

Amino Acids

21.96

Weight (kDa)

5.95

Isoelectric Point (pI)

48.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AciI CCGC 1 cut(s) 162
AclI AACGTT 1 cut(s) 479
AcuI CTGAAG 1 cut(s) 408
AfaI GTAC 3 cut(s) 196, 285, 399
AluBI AGCT 9 cut(s) 34, 41, 56, 74, 133, 314, 357, 553, 578
AluI AGCT 9 cut(s) 34, 41, 56, 74, 133, 314, 357, 553, 578
Alw26I GTCTC 2 cut(s) 91, 500
Ama87I CYCGRG 1 cut(s) 266
ApeKI GCWGC 2 cut(s) 550, 599
ArsI GACNNNNNNTTYG 2 cut(s) 344, 376
AspS9I GGNCC 2 cut(s) 408, 448
AsuHPI GGTGA 1 cut(s) 85
AsuNHI GCTAGC 1 cut(s) 574
AvaI CYCGRG 1 cut(s) 266
AvaII GGWCC 2 cut(s) 408, 448
BaeGI GKGCMC 1 cut(s) 497
BaeI ACNNNNGTAYC 2 cut(s) 381, 414
BanI GGYRCC 1 cut(s) 4
BauI CACGAG 1 cut(s) 69
BbvI GCAGC 2 cut(s) 562, 611
BccI CCATC 1 cut(s) 448
BclI TGATCA 1 cut(s) 100
BcoDI GTCTC 2 cut(s) 91, 500
BfaI CTAG 3 cut(s) 459, 554, 575
BfmI CTRYAG 1 cut(s) 309
BisI GCNGC 2 cut(s) 551, 600
BlsI GCNGC 2 cut(s) 552, 601
BmcAI AGTACT 1 cut(s) 196
Bme18I GGWCC 2 cut(s) 408, 448
BmeT110I CYCGRG 1 cut(s) 266
BmgT120I GGNCC 2 cut(s) 408, 448
BmiI GGNNCC 3 cut(s) 6, 409, 450
BmsI GCATC 2 cut(s) 542, 577
BmtI GCTAGC 1 cut(s) 578
BpuEI CTTGAG 1 cut(s) 456
BsaBI GATNNNNATC 1 cut(s) 206
Bse8I GATNNNNATC 1 cut(s) 206
BseJI GATNNNNATC 1 cut(s) 206
BseMII CTCAG 3 cut(s) 212, 338, 495
BseSI GKGCMC 1 cut(s) 497
BseXI GCAGC 2 cut(s) 562, 611
BshNI GGYRCC 1 cut(s) 4
BsiHKCI CYCGRG 1 cut(s) 266
BslFI GGGAC 3 cut(s) 256, 421, 434
BsmAI GTCTC 2 cut(s) 91, 500
BsmBI CGTCTC 1 cut(s) 500
BsmFI GGGAC 3 cut(s) 256, 421, 434
BsmI GAATGC 1 cut(s) 576
BsoBI CYCGRG 1 cut(s) 266
Bsp1286I GDGCHC 1 cut(s) 497
Bsp143I GATC 2 cut(s) 100, 207
BspACI CCGC 1 cut(s) 162
BspCNI CTCAG 3 cut(s) 211, 337, 496
BspLI GGNNCC 3 cut(s) 6, 409, 450
BspOI GCTAGC 1 cut(s) 578
BspQI GCTCTTC 1 cut(s) 540
BspT107I GGYRCC 1 cut(s) 4
BssMI GATC 2 cut(s) 100, 207
BssSI CACGAG 1 cut(s) 69
Bst2BI CACGAG 1 cut(s) 69
Bst4CI ACNGT 1 cut(s) 19
Bst6I CTCTTC 3 cut(s) 427, 540, 560
BstC8I GCNNGC 1 cut(s) 576
BstDEI CTNAG 3 cut(s) 198, 324, 504
BstKTI GATC 2 cut(s) 103, 210
BstMAI GTCTC 2 cut(s) 91, 500
BstMBI GATC 2 cut(s) 100, 207
BstMWI GCNNNNNNNGC 5 cut(s) 62, 71, 182, 363, 596
BstSFI CTRYAG 1 cut(s) 309
BstSLI GKGCMC 1 cut(s) 497
BstV1I GCAGC 2 cut(s) 562, 611
BtsI GCAGTG 1 cut(s) 127
BtsIMutI CAGTG 3 cut(s) 110, 127, 602
Cac8I GCNNGC 1 cut(s) 576
Cfr13I GGNCC 2 cut(s) 408, 448
Csp6I GTAC 3 cut(s) 195, 284, 398
CviAII CATG 3 cut(s) 83, 140, 182
CviQI GTAC 3 cut(s) 195, 284, 398
DdeI CTNAG 3 cut(s) 198, 324, 504
DpnI GATC 2 cut(s) 102, 209
DpnII GATC 2 cut(s) 100, 207
Eam1104I CTCTTC 3 cut(s) 427, 540, 560
EarI CTCTTC 3 cut(s) 427, 540, 560
Eco47I GGWCC 2 cut(s) 408, 448
Eco57I CTGAAG 1 cut(s) 408
Eco88I CYCGRG 1 cut(s) 266
EcoO109I RGGNCCY 1 cut(s) 408
Esp3I CGTCTC 1 cut(s) 500
FaeI CATG 3 cut(s) 86, 143, 185
FaiI YATR 8 cut(s) 22, 84, 141, 183, 246, 311, 446, 521
FaqI GGGAC 3 cut(s) 256, 421, 434
FatI CATG 3 cut(s) 82, 139, 181
FbaI TGATCA 1 cut(s) 100
Fnu4HI GCNGC 2 cut(s) 551, 600
Fsp4HI GCNGC 2 cut(s) 551, 600
FspBI CTAG 3 cut(s) 459, 554, 575
GluI GCNGC 2 cut(s) 551, 600
Hin1II CATG 3 cut(s) 86, 143, 185
HinfI GANTC 4 cut(s) 150, 269, 419, 431
HphI GGTGA 1 cut(s) 85
Hpy188I TCNGA 4 cut(s) 149, 201, 327, 352
Hpy188III TCNNGA 4 cut(s) 127, 435, 464, 484
HpyAV CCTTC 1 cut(s) 421
HpyCH4III ACNGT 1 cut(s) 19
HpyCH4IV ACGT 2 cut(s) 396, 479
HpyF10VI GCNNNNNNNGC 5 cut(s) 62, 71, 182, 363, 596
HpyF3I CTNAG 3 cut(s) 198, 324, 504
HpySE526I ACGT 2 cut(s) 396, 479
Hsp92II CATG 3 cut(s) 86, 143, 185
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 2 cut(s) 100, 207
LguI GCTCTTC 1 cut(s) 540
LpnPI CCDG 7 cut(s) 42, 140, 201, 389, 429, 465, 516
Lsp1109I GCAGC 2 cut(s) 562, 611
LweI GCATC 2 cut(s) 542, 577
MaeI CTAG 3 cut(s) 459, 554, 575
MaeII ACGT 2 cut(s) 396, 479
MaeIII GTNAC 3 cut(s) 13, 235, 523
MalI GATC 2 cut(s) 102, 209
MboI GATC 2 cut(s) 100, 207
MboII GAAGA 4 cut(s) 414, 557, 569, 577
MhlI GDGCHC 1 cut(s) 497
MlyI GAGTC 3 cut(s) 159, 278, 413
MmeI TCCRAC 1 cut(s) 413
MnlI CCTC 3 cut(s) 275, 333, 484
MseI TTAA 3 cut(s) 36, 156, 613
Mva1269I GAATGC 1 cut(s) 576
MwoI GCNNNNNNNGC 5 cut(s) 62, 71, 182, 363, 596
NdeII GATC 2 cut(s) 100, 207
NheI GCTAGC 1 cut(s) 574
NlaIII CATG 3 cut(s) 86, 143, 185
NlaIV GGNNCC 3 cut(s) 6, 409, 450
NmuCI GTSAC 1 cut(s) 523
PaeR7I CTCGAG 1 cut(s) 266
PciSI GCTCTTC 1 cut(s) 540
PctI GAATGC 1 cut(s) 576
PfeI GAWTC 1 cut(s) 431
PflFI GACNNNGTC 1 cut(s) 511
PkrI GCNGC 2 cut(s) 552, 601
PleI GAGTC 3 cut(s) 158, 277, 413
PpsI GAGTC 3 cut(s) 158, 277, 413
PpuMI RGGWCCY 1 cut(s) 408
Psp1406I AACGTT 1 cut(s) 479
Psp5II RGGWCCY 1 cut(s) 408
PspN4I GGNNCC 3 cut(s) 6, 409, 450
PspPI GGNCC 2 cut(s) 408, 448
PspPPI RGGWCCY 1 cut(s) 408
PspXI VCTCGAGB 1 cut(s) 266
PsyI GACNNNGTC 1 cut(s) 511
RsaI GTAC 3 cut(s) 196, 285, 399
RsaNI GTAC 3 cut(s) 195, 284, 398
SapI GCTCTTC 1 cut(s) 540
SaqAI TTAA 3 cut(s) 36, 156, 613
SatI GCNGC 2 cut(s) 551, 600
Sau3AI GATC 2 cut(s) 100, 207
Sau96I GGNCC 2 cut(s) 408, 448
ScaI AGTACT 1 cut(s) 196
SchI GAGTC 3 cut(s) 159, 278, 413
SduI GDGCHC 1 cut(s) 497
SfaNI GCATC 2 cut(s) 542, 577
SfcI CTRYAG 1 cut(s) 309
Sfr274I CTCGAG 1 cut(s) 266
SinI GGWCC 2 cut(s) 408, 448
SlaI CTCGAG 1 cut(s) 266
SmlI CTYRAG 2 cut(s) 266, 471
SmoI CTYRAG 2 cut(s) 266, 471
SsiI CCGC 1 cut(s) 162
SspMI CTAG 3 cut(s) 459, 554, 575
TaaI ACNGT 1 cut(s) 19
TaiI ACGT 2 cut(s) 399, 482
TaqI TCGA 3 cut(s) 50, 267, 483
TatI WGTACW 2 cut(s) 194, 283
TfiI GAWTC 1 cut(s) 431
Tru1I TTAA 3 cut(s) 36, 156, 613
Tru9I TTAA 3 cut(s) 36, 156, 613
TscAI CASTG 3 cut(s) 117, 127, 609
TseFI GTSAC 1 cut(s) 523
TseI GCWGC 2 cut(s) 550, 599
Tsp45I GTSAC 1 cut(s) 523
TspDTI ATGAA 2 cut(s) 328, 578
TspRI CASTG 3 cut(s) 117, 127, 609
Tth111I GACNNNGTC 1 cut(s) 511
VpaK11BI GGWCC 2 cut(s) 408, 448
XhoI CTCGAG 1 cut(s) 266
XspI CTAG 3 cut(s) 459, 554, 575
ZrmI AGTACT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.