pycom04g05010

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Forward (+)
4654864 .. 4655694
831 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g05010.1

Sequence Viewer

Length: 831 bp
ATGGAGTTAAGCATCACCCGTCATGGGAAGAAAGAACAGATCGCCGACTACAAGAATGACAAAGTTTTGGGGCCAAAGGTGGATAAGGCTGCGTGGAAACCCACCAAGGAAGCAATGACGGTCAACACAACTCCAGTCAAAATCCGTACACGAAGCAAGGCGATTCAAACCGAAGCTTTTCGTGATCAAGAGATACGTAAACGCACTTTGAAGGAGCTTGAGGAGAAGACTTATCCATTCCCCGACTCTGACGTGGTTGCCATGTTGAAAGACTTGCTTGACAAAAAGGTGATCGACCTACCTAAGTGCAAACGGCCAGAAGATATGAACCGTACTGACAGTCCAAGGTACTGTAAATTCCACCGCTTCATTAGTCATCCGACGGAAAAGTGCTTTGTGCTAAAAGATCTCATCATGAAGTTGGCTCAGAAAGGGATCATCGAGCTAGATCTTAATGATGTGGTGAAGTCAAACTATATCACCGCCACTTCTGGCTCTTTGAACTCAAAATCTTCACCTCAACCGCTAGGGGCATGCTCCAAAACCATGTCAGTCAAGTCAAGTGAAGTTGAAGGATGGACTTATGTCACTCCAAAGAAAATGCACAAGAAACATAGGTCTCCTCCACAAGTTCACCAATCGGAAAGGGAGCAAAGCAGCTACCGTCAACCTTCAAAGCTACATGAAAGTGTTGAGGATGATGAAGTTATGACACAAAGATCGTCCGTTGCCATCACGATGCGCGATTTCTTCCCCAAAGACTTCTTCAATCACTCAGTCAAGACTCCTTGCTATAAAGATTGCAAGGAATGCCTCTCTAAGATCGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

277

Amino Acids

31.81

Weight (kDa)

9.35

Isoelectric Point (pI)

48.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 744
AciI CCGC 3 cut(s) 364, 483, 524
AclWI GGATC 1 cut(s) 443
AcoI YGGCCR 1 cut(s) 314
AcsI RAATTY 1 cut(s) 356
AfaI GTAC 3 cut(s) 148, 334, 350
AfiI CCNNNNNNNGG 1 cut(s) 24
AgsI TTSAA 7 cut(s) 167, 211, 268, 502, 572, 675, 769
AjiI CACGTC 1 cut(s) 253
AjuI GAANNNNNNNTTGG 2 cut(s) 749, 781
AluBI AGCT 5 cut(s) 176, 217, 445, 660, 679
AluI AGCT 5 cut(s) 176, 217, 445, 660, 679
Alw26I GTCTC 1 cut(s) 624
AlwI GGATC 1 cut(s) 443
AoxI GGCC 2 cut(s) 71, 314
ApeKI GCWGC 2 cut(s) 89, 657
ApoI RAATTY 1 cut(s) 356
Asp700I GAANNNNTTC 1 cut(s) 177
AspLEI GCGC 1 cut(s) 744
AspS9I GGNCC 1 cut(s) 71
AsuHPI GGTGA 6 cut(s) 7, 301, 472, 475, 507, 626
BbsI GAAGAC 1 cut(s) 233
BbvI GCAGC 2 cut(s) 76, 669
BccI CCATC 2 cut(s) 570, 740
BceAI ACGGC 1 cut(s) 329
BclI TGATCA 1 cut(s) 184
BcoDI GTCTC 1 cut(s) 624
BfaI CTAG 2 cut(s) 446, 527
BglII AGATCT 2 cut(s) 406, 448
BisI GCNGC 2 cut(s) 90, 658
BlsI GCNGC 2 cut(s) 91, 659
BmgBI CACGTC 1 cut(s) 253
BmgT120I GGNCC 1 cut(s) 71
BmiI GGNNCC 1 cut(s) 72
BmsI GCATC 2 cut(s) 21, 729
BoxI GACNNNNGTC 1 cut(s) 584
BpiI GAAGAC 1 cut(s) 233
BpmI CTGGAG 1 cut(s) 117
BpuEI CTTGAG 1 cut(s) 239
BsaAI YACGTR 1 cut(s) 197
BsaI GGTCTC 1 cut(s) 624
BsaJI CCNNGG 2 cut(s) 105, 344
Bsc4I CCNNNNNNNGG 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 134
Bse3DI GCAATG 1 cut(s) 120
BseDI CCNNGG 2 cut(s) 105, 344
BseGI GGATG 3 cut(s) 376, 581, 703
BseLI CCNNNNNNNGG 1 cut(s) 24
BseMI GCAATG 1 cut(s) 120
BseMII CTCAG 2 cut(s) 440, 789
BseNI ACTGG 1 cut(s) 134
BseRI GAGGAG 2 cut(s) 236, 612
BseXI GCAGC 2 cut(s) 76, 669
Bsh1236I CGCG 1 cut(s) 744
BshFI GGCC 2 cut(s) 73, 316
BslI CCNNNNNNNGG 1 cut(s) 24
BsmAI GTCTC 1 cut(s) 624
BsmI GAATGC 1 cut(s) 815
BsnI GGCC 2 cut(s) 73, 316
Bso31I GGTCTC 1 cut(s) 624
Bsp143I GATC 8 cut(s) 39, 184, 291, 406, 435, 448, 719, 822
BspACI CCGC 3 cut(s) 364, 483, 524
BspANI GGCC 2 cut(s) 73, 316
BspCNI CTCAG 2 cut(s) 439, 788
BspFNI CGCG 1 cut(s) 744
BspHI TCATGA 1 cut(s) 414
BspLI GGNNCC 1 cut(s) 72
BspPI GGATC 1 cut(s) 443
BspTNI GGTCTC 1 cut(s) 624
BsrDI GCAATG 1 cut(s) 120
BsrI ACTGG 1 cut(s) 134
BssECI CCNNGG 2 cut(s) 105, 344
BssMI GATC 8 cut(s) 39, 184, 291, 406, 435, 448, 719, 822
BssT1I CCWWGG 2 cut(s) 105, 344
Bst4CI ACNGT 5 cut(s) 121, 332, 341, 353, 665
BstAPI GCANNNNNTGC 1 cut(s) 810
BstBAI YACGTR 1 cut(s) 197
BstC8I GCNNGC 1 cut(s) 535
BstDEI CTNAG 4 cut(s) 303, 426, 775, 819
BstF5I GGATG 3 cut(s) 376, 581, 703
BstFNI CGCG 1 cut(s) 744
BstHHI GCGC 1 cut(s) 744
BstKTI GATC 8 cut(s) 42, 187, 294, 409, 438, 451, 722, 825
BstMAI GTCTC 1 cut(s) 624
BstMBI GATC 8 cut(s) 39, 184, 291, 406, 435, 448, 719, 822
BstMWI GCNNNNNNNGC 1 cut(s) 810
BstNSI RCATGY 1 cut(s) 537
BstPAI GACNNNNGTC 1 cut(s) 584
BstSNI TACGTA 1 cut(s) 197
BstUI CGCG 1 cut(s) 744
BstV1I GCAGC 2 cut(s) 76, 669
BstV2I GAAGAC 1 cut(s) 233
BstX2I RGATCY 2 cut(s) 406, 448
BstYI RGATCY 2 cut(s) 406, 448
BsuRI GGCC 2 cut(s) 73, 316
BtrI CACGTC 1 cut(s) 253
BtsCI GGATG 3 cut(s) 376, 581, 703
Cac8I GCNNGC 1 cut(s) 535
CciI TCATGA 1 cut(s) 414
CfoI GCGC 1 cut(s) 744
Cfr13I GGNCC 1 cut(s) 71
Csp6I GTAC 3 cut(s) 147, 333, 349
CviAII CATG 6 cut(s) 23, 262, 415, 534, 547, 683
CviQI GTAC 3 cut(s) 147, 333, 349
DdeI CTNAG 4 cut(s) 303, 426, 775, 819
DpnI GATC 8 cut(s) 41, 186, 293, 408, 437, 450, 721, 824
DpnII GATC 8 cut(s) 39, 184, 291, 406, 435, 448, 719, 822
EaeI YGGCCR 1 cut(s) 314
Eco105I TACGTA 1 cut(s) 197
Eco130I CCWWGG 2 cut(s) 105, 344
Eco31I GGTCTC 1 cut(s) 624
EcoT14I CCWWGG 2 cut(s) 105, 344
ErhI CCWWGG 2 cut(s) 105, 344
FaeI CATG 6 cut(s) 26, 265, 418, 537, 550, 686
FalI AAGNNNNNCTT 2 cut(s) 261, 293
FatI CATG 6 cut(s) 22, 261, 414, 533, 546, 682
FbaI TGATCA 1 cut(s) 184
Fnu4HI GCNGC 2 cut(s) 90, 658
FokI GGATG 3 cut(s) 363, 588, 710
Fsp4HI GCNGC 2 cut(s) 90, 658
FspBI CTAG 2 cut(s) 446, 527
GlaI GCGC 1 cut(s) 743
GluI GCNGC 2 cut(s) 90, 658
GsuI CTGGAG 1 cut(s) 117
HaeIII GGCC 2 cut(s) 73, 316
HhaI GCGC 1 cut(s) 744
Hin1II CATG 6 cut(s) 26, 265, 418, 537, 550, 686
Hin6I GCGC 1 cut(s) 742
HinP1I GCGC 1 cut(s) 742
HincII GTYRAC 2 cut(s) 124, 668
HindII GTYRAC 2 cut(s) 124, 668
HindIII AAGCTT 1 cut(s) 174
HinfI GANTC 3 cut(s) 163, 245, 784
HphI GGTGA 6 cut(s) 7, 301, 472, 475, 507, 626
Hpy166II GTNNAC 5 cut(s) 124, 149, 200, 634, 668
Hpy188I TCNGA 4 cut(s) 250, 381, 429, 643
Hpy188III TCNNGA 5 cut(s) 182, 188, 415, 736, 781
Hpy8I GTNNAC 5 cut(s) 124, 149, 200, 634, 668
Hpy99I CGWCG 1 cut(s) 385
HpyAV CCTTC 3 cut(s) 205, 566, 681
HpyCH4III ACNGT 5 cut(s) 121, 332, 341, 353, 665
HpyCH4IV ACGT 2 cut(s) 196, 252
HpyCH4V TGCA 3 cut(s) 309, 604, 804
HpyF10VI GCNNNNNNNGC 1 cut(s) 810
HpyF3I CTNAG 4 cut(s) 303, 426, 775, 819
HpySE526I ACGT 2 cut(s) 196, 252
Hsp92II CATG 6 cut(s) 26, 265, 418, 537, 550, 686
HspAI GCGC 1 cut(s) 742
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 8 cut(s) 39, 184, 291, 406, 435, 448, 719, 822
LmnI GCTCC 3 cut(s) 214, 542, 649
LpnPI CCDG 3 cut(s) 147, 330, 477
Lsp1109I GCAGC 2 cut(s) 76, 669
LweI GCATC 2 cut(s) 21, 729
MaeI CTAG 2 cut(s) 446, 527
MaeII ACGT 2 cut(s) 196, 252
MaeIII GTNAC 1 cut(s) 586
MalI GATC 8 cut(s) 41, 186, 293, 408, 437, 450, 721, 824
MboI GATC 8 cut(s) 39, 184, 291, 406, 435, 448, 719, 822
MboII GAAGA 6 cut(s) 40, 238, 332, 504, 742, 757
MflI RGATCY 2 cut(s) 406, 448
MluCI AATT 1 cut(s) 356
MlyI GAGTC 2 cut(s) 239, 778
MmeI TCCRAC 1 cut(s) 404
MnlI CCTC 5 cut(s) 214, 528, 633, 688, 824
MroXI GAANNNNTTC 1 cut(s) 177
MseI TTAA 2 cut(s) 8, 453
MslI CAYNNNNRTG 2 cut(s) 687, 737
Mva1269I GAATGC 1 cut(s) 815
MvnI CGCG 1 cut(s) 744
MwoI GCNNNNNNNGC 1 cut(s) 810
NdeII GATC 8 cut(s) 39, 184, 291, 406, 435, 448, 719, 822
NlaIII CATG 6 cut(s) 26, 265, 418, 537, 550, 686
NlaIV GGNNCC 1 cut(s) 72
NmuCI GTSAC 1 cut(s) 586
NspI RCATGY 1 cut(s) 537
PaeI GCATGC 1 cut(s) 537
PagI TCATGA 1 cut(s) 414
PctI GAATGC 1 cut(s) 815
PdmI GAANNNNTTC 1 cut(s) 177
PfeI GAWTC 1 cut(s) 163
PkrI GCNGC 2 cut(s) 91, 659
PleI GAGTC 2 cut(s) 239, 778
PpsI GAGTC 2 cut(s) 239, 778
Ppu21I YACGTR 1 cut(s) 197
PshAI GACNNNNGTC 1 cut(s) 584
PspN4I GGNNCC 1 cut(s) 72
PspPI GGNCC 1 cut(s) 71
PsuI RGATCY 2 cut(s) 406, 448
RsaI GTAC 3 cut(s) 148, 334, 350
RsaNI GTAC 3 cut(s) 147, 333, 349
RseI CAYNNNNRTG 2 cut(s) 687, 737
SaqAI TTAA 2 cut(s) 8, 453
SatI GCNGC 2 cut(s) 90, 658
Sau3AI GATC 8 cut(s) 39, 184, 291, 406, 435, 448, 719, 822
Sau96I GGNCC 1 cut(s) 71
SchI GAGTC 2 cut(s) 239, 778
SfaNI GCATC 2 cut(s) 21, 729
SmiMI CAYNNNNRTG 2 cut(s) 687, 737
SmlI CTYRAG 1 cut(s) 218
SmoI CTYRAG 1 cut(s) 218
SnaBI TACGTA 1 cut(s) 197
SphI GCATGC 1 cut(s) 537
Sse9I AATT 1 cut(s) 356
SsiI CCGC 3 cut(s) 364, 483, 524
SspMI CTAG 2 cut(s) 446, 527
StyI CCWWGG 2 cut(s) 105, 344
TaaI ACNGT 5 cut(s) 121, 332, 341, 353, 665
TaiI ACGT 2 cut(s) 199, 255
TaqI TCGA 2 cut(s) 294, 441
TasI AATT 1 cut(s) 356
TfiI GAWTC 1 cut(s) 163
Tru1I TTAA 2 cut(s) 8, 453
Tru9I TTAA 2 cut(s) 8, 453
TseFI GTSAC 1 cut(s) 586
TseI GCWGC 2 cut(s) 89, 657
Tsp45I GTSAC 1 cut(s) 586
TspDTI ATGAA 5 cut(s) 341, 358, 431, 699, 717
TspGWI ACGGA 3 cut(s) 134, 398, 715
XapI RAATTY 1 cut(s) 356
XceI RCATGY 1 cut(s) 537
XmnI GAANNNNTTC 1 cut(s) 177
XspI CTAG 2 cut(s) 446, 527
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.