Rmu_sc0002811.1_g000016

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002811.1
OG0000128
Physical Location & Seq
Forward (+)
45704 .. 46252
549 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002811.1_g000016.1.cds

Sequence Viewer

Length: 549 bp
atggtccctattgttagtcaacatactcaagccttgtttgagacaaatgacggcacaaagcatgtgactatgtcagttatggtcaaaaatgcatcaacaatagaagagcagctagaagaaatgaagagaatgctagctgaaaaagatgctcaaatagcagcactgacttctcaattggctactatggctaacataagtgatcataaaaataatgaaaagagtgatcgtgaaaagaacatcggaggacatggttccacaatcgcaagtcttgaagacataaagacactaattgcagaaggaatccgtgaagtatacacctcctcaaatccacagttctctgggtacttgaaaccctaccctactcattacgatgcactaccattccctaagggctatcacaagccaacttttgacaagtttgatgcagtagatggctctctgcatgaacatttggctcatttcttctcagcttgtggggaaacatcacagtcagatgcattgttaataaggcagtttgttcagtccctcagaggagcagcttttacttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 Retrotrans_gag rve

Protein Analysis

182

Amino Acids

20.16

Weight (kDa)

5.81

Isoelectric Point (pI)

43.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 312
AfaI GTAC 1 cut(s) 344
AgsI TTSAA 2 cut(s) 272, 349
AluBI AGCT 4 cut(s) 112, 137, 470, 539
AluI AGCT 4 cut(s) 112, 137, 470, 539
Alw26I GTCTC 1 cut(s) 35
ApeKI GCWGC 3 cut(s) 109, 158, 536
AspS9I GGNCC 1 cut(s) 4
AsuNHI GCTAGC 1 cut(s) 133
AvaII GGWCC 1 cut(s) 4
AxyI CCTNAGG 1 cut(s) 387
BbsI GAAGAC 1 cut(s) 279
BbvI GCAGC 2 cut(s) 121, 170
BccI CCATC 1 cut(s) 425
BceAI ACGGC 1 cut(s) 67
BclI TGATCA 1 cut(s) 199
BcoDI GTCTC 1 cut(s) 35
BfaI CTAG 2 cut(s) 113, 134
BisI GCNGC 3 cut(s) 110, 159, 537
BlsI GCNGC 3 cut(s) 111, 160, 538
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 2 cut(s) 6, 253
BmsI GCATC 5 cut(s) 101, 136, 361, 412, 484
BmtI GCTAGC 1 cut(s) 137
BpiI GAAGAC 1 cut(s) 279
BpuEI CTTGAG 1 cut(s) 12
Bse21I CCTNAGG 1 cut(s) 387
BseMII CTCAG 2 cut(s) 480, 541
BseRI GAGGAG 2 cut(s) 310, 546
BseXI GCAGC 2 cut(s) 121, 170
BslFI GGGAC 1 cut(s) 508
BsmAI GTCTC 1 cut(s) 35
BsmFI GGGAC 1 cut(s) 508
BsmI GAATGC 1 cut(s) 135
Bsp143I GATC 2 cut(s) 199, 223
BspCNI CTCAG 2 cut(s) 479, 540
BspLI GGNNCC 2 cut(s) 6, 253
BspOI GCTAGC 1 cut(s) 137
BspQI GCTCTTC 1 cut(s) 99
BssMI GATC 2 cut(s) 199, 223
BssNAI GTATAC 1 cut(s) 313
Bst1107I GTATAC 1 cut(s) 313
Bst4CI ACNGT 2 cut(s) 333, 489
Bst6I CTCTTC 2 cut(s) 99, 119
BstC8I GCNNGC 1 cut(s) 135
BstDEI CTNAG 4 cut(s) 387, 466, 527, 546
BstKTI GATC 2 cut(s) 202, 226
BstMAI GTCTC 1 cut(s) 35
BstMBI GATC 2 cut(s) 199, 223
BstMWI GCNNNNNNNGC 2 cut(s) 155, 185
BstNSI RCATGY 1 cut(s) 65
BstV1I GCAGC 2 cut(s) 121, 170
BstV2I GAAGAC 1 cut(s) 279
BstZ17I GTATAC 1 cut(s) 313
Bsu36I CCTNAGG 1 cut(s) 387
BtsIMutI CAGTG 1 cut(s) 161
Cac8I GCNNGC 1 cut(s) 135
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 343
CviAII CATG 3 cut(s) 62, 248, 443
CviQI GTAC 1 cut(s) 343
DdeI CTNAG 4 cut(s) 387, 466, 527, 546
DpnI GATC 2 cut(s) 201, 225
DpnII GATC 2 cut(s) 199, 223
Eam1104I CTCTTC 2 cut(s) 99, 119
EarI CTCTTC 2 cut(s) 99, 119
Eco47I GGWCC 1 cut(s) 4
Eco81I CCTNAGG 1 cut(s) 387
EcoT22I ATGCAT 2 cut(s) 94, 499
FaeI CATG 3 cut(s) 65, 251, 446
FaqI GGGAC 1 cut(s) 508
FatI CATG 3 cut(s) 61, 247, 442
FbaI TGATCA 1 cut(s) 199
FblI GTMKAC 1 cut(s) 312
Fnu4HI GCNGC 3 cut(s) 110, 159, 537
Fsp4HI GCNGC 3 cut(s) 110, 159, 537
FspBI CTAG 2 cut(s) 113, 134
GluI GCNGC 3 cut(s) 110, 159, 537
Hin1II CATG 3 cut(s) 65, 251, 446
HincII GTYRAC 1 cut(s) 20
HindII GTYRAC 1 cut(s) 20
HinfI GANTC 1 cut(s) 300
Hpy166II GTNNAC 2 cut(s) 20, 313
Hpy188I TCNGA 3 cut(s) 242, 493, 530
Hpy188III TCNNGA 2 cut(s) 227, 269
Hpy8I GTNNAC 2 cut(s) 20, 313
HpyAV CCTTC 1 cut(s) 290
HpyCH4III ACNGT 2 cut(s) 333, 489
HpyCH4V TGCA 6 cut(s) 92, 293, 374, 425, 442, 497
HpyF10VI GCNNNNNNNGC 2 cut(s) 155, 185
HpyF3I CTNAG 4 cut(s) 387, 466, 527, 546
Hsp92II CATG 3 cut(s) 65, 251, 446
Ksp22I TGATCA 1 cut(s) 199
Kzo9I GATC 2 cut(s) 199, 223
LguI GCTCTTC 1 cut(s) 99
LmnI GCTCC 1 cut(s) 533
LpnPI CCDG 1 cut(s) 324
Lsp1109I GCAGC 2 cut(s) 121, 170
LweI GCATC 5 cut(s) 101, 136, 361, 412, 484
MaeI CTAG 2 cut(s) 113, 134
MaeIII GTNAC 1 cut(s) 64
MalI GATC 2 cut(s) 201, 225
MboI GATC 2 cut(s) 199, 223
MboII GAAGA 5 cut(s) 116, 128, 136, 284, 454
MfeI CAATTG 1 cut(s) 173
MluCI AATT 2 cut(s) 173, 288
MnlI CCTC 5 cut(s) 236, 328, 331, 524, 536
Mph1103I ATGCAT 2 cut(s) 94, 499
MseI TTAA 1 cut(s) 503
MslI CAYNNNNRTG 1 cut(s) 369
MunI CAATTG 1 cut(s) 173
Mva1269I GAATGC 1 cut(s) 135
MwoI GCNNNNNNNGC 2 cut(s) 155, 185
NdeII GATC 2 cut(s) 199, 223
NheI GCTAGC 1 cut(s) 133
NlaIII CATG 3 cut(s) 65, 251, 446
NlaIV GGNNCC 2 cut(s) 6, 253
NmuCI GTSAC 1 cut(s) 64
NsiI ATGCAT 2 cut(s) 94, 499
NspI RCATGY 1 cut(s) 65
PciSI GCTCTTC 1 cut(s) 99
PctI GAATGC 1 cut(s) 135
PfeI GAWTC 1 cut(s) 300
PflFI GACNNNGTC 1 cut(s) 70
PkrI GCNGC 3 cut(s) 111, 160, 538
PspN4I GGNNCC 2 cut(s) 6, 253
PspPI GGNCC 1 cut(s) 4
PsyI GACNNNGTC 1 cut(s) 70
RsaI GTAC 1 cut(s) 344
RsaNI GTAC 1 cut(s) 343
RseI CAYNNNNRTG 1 cut(s) 369
SapI GCTCTTC 1 cut(s) 99
SaqAI TTAA 1 cut(s) 503
SatI GCNGC 3 cut(s) 110, 159, 537
Sau3AI GATC 2 cut(s) 199, 223
Sau96I GGNCC 1 cut(s) 4
SetI ASST 5 cut(s) 114, 139, 320, 472, 541
SfaNI GCATC 5 cut(s) 101, 136, 361, 412, 484
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 369
SmlI CTYRAG 1 cut(s) 27
SmoI CTYRAG 1 cut(s) 27
Sse9I AATT 2 cut(s) 173, 288
SspMI CTAG 2 cut(s) 113, 134
TaaI ACNGT 2 cut(s) 333, 489
TasI AATT 2 cut(s) 173, 288
TfiI GAWTC 1 cut(s) 300
Tru1I TTAA 1 cut(s) 503
Tru9I TTAA 1 cut(s) 503
TscAI CASTG 1 cut(s) 168
TseFI GTSAC 1 cut(s) 64
TseI GCWGC 3 cut(s) 109, 158, 536
Tsp45I GTSAC 1 cut(s) 64
TspDTI ATGAA 3 cut(s) 137, 228, 459
TspGWI ACGGA 1 cut(s) 293
TspRI CASTG 1 cut(s) 168
Tth111I GACNNNGTC 1 cut(s) 70
VpaK11BI GGWCC 1 cut(s) 4
XceI RCATGY 1 cut(s) 65
XmiI GTMKAC 1 cut(s) 312
XspI CTAG 2 cut(s) 113, 134
Zsp2I ATGCAT 2 cut(s) 94, 499
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.