Rmu_sc0001167.1_g000047

Uncharacterized protein K02A2.6-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001167.1
OG0000128
Physical Location & Seq
Forward (+)
190507 .. 190959
453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001167.1_g000047.1.cds

Sequence Viewer

Length: 453 bp
atgaagcgacgctctatgttagaggtgagctcaagcgaacaactcaaagtgaaggagcacaccatcgtactcactggccaagtcaaaactggtaatgttgatggcaatgacgaagatgagatttttcaatctgcctatcatattaccgtagcagaagcagaggcttttgaagaagatgaccatgatcattcagaggatgaagtagatgaagctccaccagaacttgaagacggggggcaagctactatcgacgagcttaaagagcttaatttgggaactgaggaagatccaagacctgtcttcgtgagcgcttcgctgagtcccgaagaagaaaagaaatactatgatctactgcttgaatataaagacatctttgcatggacgtacaaagaaatgcctggtcttgacccaaaggtagcagttcatcgtctcgctgttaaacttgaggcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 rve

Protein Analysis

150

Amino Acids

16.98

Weight (kDa)

4.35

Isoelectric Point (pI)

54.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 281
AcoI YGGCCR 1 cut(s) 76
AfaI GTAC 2 cut(s) 69, 386
AfeI AGCGCT 1 cut(s) 310
AgsI TTSAA 4 cut(s) 128, 170, 227, 359
AjnI CCWGG 1 cut(s) 397
AluBI AGCT 5 cut(s) 30, 212, 242, 256, 265
AluI AGCT 5 cut(s) 30, 212, 242, 256, 265
Alw21I GWGCWC 2 cut(s) 32, 60
Alw26I GTCTC 1 cut(s) 434
AlwI GGATC 1 cut(s) 281
Aor51HI AGCGCT 1 cut(s) 310
AoxI GGCC 1 cut(s) 76
AspLEI GCGC 1 cut(s) 311
AsuHPI GGTGA 1 cut(s) 37
BalI TGGCCA 1 cut(s) 78
BanII GRGCYC 1 cut(s) 32
BbsI GAAGAC 2 cut(s) 234, 292
Bbv12I GWGCWC 2 cut(s) 32, 60
BccI CCATC 2 cut(s) 71, 95
BciT130I CCWGG 1 cut(s) 399
BclI TGATCA 1 cut(s) 184
BcoDI GTCTC 1 cut(s) 434
BfoI RGCGCY 1 cut(s) 312
Bme1390I CCNGG 1 cut(s) 399
BmrFI CCNGG 1 cut(s) 399
BpiI GAAGAC 2 cut(s) 234, 292
BplI GAGNNNNNCTC 2 cut(s) 14, 46
BpuEI CTTGAG 1 cut(s) 16
Bse1I ACTGG 2 cut(s) 79, 94
Bse3DI GCAATG 1 cut(s) 112
BseBI CCWGG 1 cut(s) 399
BseGI GGATG 1 cut(s) 202
BseMI GCAATG 1 cut(s) 112
BseMII CTCAG 2 cut(s) 270, 308
BseNI ACTGG 2 cut(s) 79, 94
BshFI GGCC 1 cut(s) 78
BsiHKAI GWGCWC 2 cut(s) 32, 60
BslFI GGGAC 1 cut(s) 306
BsmAI GTCTC 1 cut(s) 434
BsmBI CGTCTC 1 cut(s) 434
BsmFI GGGAC 1 cut(s) 306
BsnI GGCC 1 cut(s) 78
Bsp1286I GDGCHC 2 cut(s) 32, 60
Bsp143I GATC 3 cut(s) 184, 286, 346
BspANI GGCC 1 cut(s) 78
BspCNI CTCAG 2 cut(s) 271, 309
BspPI GGATC 1 cut(s) 281
BsrDI GCAATG 1 cut(s) 112
BsrI ACTGG 2 cut(s) 79, 94
BssMI GATC 3 cut(s) 184, 286, 346
Bst2UI CCWGG 1 cut(s) 399
Bst4CI ACNGT 1 cut(s) 148
BstC8I GCNNGC 1 cut(s) 240
BstDEI CTNAG 2 cut(s) 279, 317
BstF5I GGATG 1 cut(s) 202
BstH2I RGCGCY 1 cut(s) 312
BstHHI GCGC 1 cut(s) 311
BstKTI GATC 3 cut(s) 187, 289, 349
BstMAI GTCTC 1 cut(s) 434
BstMBI GATC 3 cut(s) 184, 286, 346
BstMWI GCNNNNNNNGC 1 cut(s) 262
BstNI CCWGG 1 cut(s) 399
BstSCI CCNGG 1 cut(s) 397
BstV2I GAAGAC 2 cut(s) 234, 292
BstX2I RGATCY 1 cut(s) 286
BstYI RGATCY 1 cut(s) 286
BsuRI GGCC 1 cut(s) 78
BtsCI GGATG 1 cut(s) 202
BtsIMutI CAGTG 1 cut(s) 72
Cac8I GCNNGC 1 cut(s) 240
CfoI GCGC 1 cut(s) 311
CseI GACGC 1 cut(s) 18
Csp6I GTAC 2 cut(s) 68, 385
CviAII CATG 2 cut(s) 182, 378
CviJI RGCY 8 cut(s) 30, 78, 164, 212, 242, 256, 265, 449
CviKI_1 RGCY 8 cut(s) 30, 78, 164, 212, 242, 256, 265, 449
CviQI GTAC 2 cut(s) 68, 385
DdeI CTNAG 2 cut(s) 279, 317
DpnI GATC 3 cut(s) 186, 288, 348
DpnII GATC 3 cut(s) 184, 286, 346
EaeI YGGCCR 1 cut(s) 76
Ecl136II GAGCTC 1 cut(s) 30
Eco24I GRGCYC 1 cut(s) 32
Eco47III AGCGCT 1 cut(s) 310
Eco53kI GAGCTC 1 cut(s) 30
EcoICRI GAGCTC 1 cut(s) 30
EcoRII CCWGG 1 cut(s) 397
EcoT38I GRGCYC 1 cut(s) 32
Esp3I CGTCTC 1 cut(s) 434
FaeI CATG 2 cut(s) 185, 381
FaiI YATR 6 cut(s) 17, 141, 183, 345, 363, 379
FaqI GGGAC 1 cut(s) 306
FatI CATG 2 cut(s) 181, 377
FbaI TGATCA 1 cut(s) 184
FokI GGATG 1 cut(s) 209
FriOI GRGCYC 1 cut(s) 32
GlaI GCGC 1 cut(s) 310
HaeII RGCGCY 1 cut(s) 312
HaeIII GGCC 1 cut(s) 78
HgaI GACGC 1 cut(s) 18
HhaI GCGC 1 cut(s) 311
Hin1II CATG 2 cut(s) 185, 381
Hin6I GCGC 1 cut(s) 309
HinP1I GCGC 1 cut(s) 309
HinfI GANTC 1 cut(s) 319
HphI GGTGA 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 193
Hpy188III TCNNGA 3 cut(s) 304, 323, 404
Hpy99I CGWCG 2 cut(s) 12, 254
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 1 cut(s) 148
HpyCH4IV ACGT 1 cut(s) 383
HpyCH4V TGCA 1 cut(s) 377
HpyF10VI GCNNNNNNNGC 1 cut(s) 262
HpyF3I CTNAG 2 cut(s) 279, 317
HpySE526I ACGT 1 cut(s) 383
Hsp92II CATG 2 cut(s) 185, 381
HspAI GCGC 1 cut(s) 309
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 3 cut(s) 184, 286, 346
LmnI GCTCC 2 cut(s) 55, 217
LpnPI CCDG 6 cut(s) 60, 75, 231, 309, 384, 411
MaeII ACGT 1 cut(s) 383
MalI GATC 3 cut(s) 186, 288, 348
MboI GATC 3 cut(s) 184, 286, 346
MboII GAAGA 8 cut(s) 125, 182, 185, 239, 292, 296, 338, 341
MflI RGATCY 1 cut(s) 286
MhlI GDGCHC 2 cut(s) 32, 60
MlsI TGGCCA 1 cut(s) 78
MluCI AATT 1 cut(s) 268
MluNI TGGCCA 1 cut(s) 78
MlyI GAGTC 1 cut(s) 328
MnlI CCTC 5 cut(s) 16, 154, 187, 274, 439
Mox20I TGGCCA 1 cut(s) 78
MscI TGGCCA 1 cut(s) 78
MseI TTAA 3 cut(s) 258, 267, 438
Msp20I TGGCCA 1 cut(s) 78
MspR9I CCNGG 1 cut(s) 399
MvaI CCWGG 1 cut(s) 399
MwoI GCNNNNNNNGC 1 cut(s) 262
NdeII GATC 3 cut(s) 184, 286, 346
NlaIII CATG 2 cut(s) 185, 381
PleI GAGTC 1 cut(s) 327
PpsI GAGTC 1 cut(s) 327
Psp124BI GAGCTC 1 cut(s) 32
Psp6I CCWGG 1 cut(s) 397
PspGI CCWGG 1 cut(s) 397
PsuI RGATCY 1 cut(s) 286
RsaI GTAC 2 cut(s) 69, 386
RsaNI GTAC 2 cut(s) 68, 385
SacI GAGCTC 1 cut(s) 32
SaqAI TTAA 3 cut(s) 258, 267, 438
Sau3AI GATC 3 cut(s) 184, 286, 346
SchI GAGTC 1 cut(s) 328
ScrFI CCNGG 1 cut(s) 399
SduI GDGCHC 2 cut(s) 32, 60
SetI ASST 9 cut(s) 27, 32, 214, 244, 258, 267, 298, 386, 417
SmlI CTYRAG 2 cut(s) 31, 443
SmoI CTYRAG 2 cut(s) 31, 443
Sse9I AATT 1 cut(s) 268
SstI GAGCTC 1 cut(s) 32
StyD4I CCNGG 1 cut(s) 397
TaaI ACNGT 1 cut(s) 148
TaiI ACGT 1 cut(s) 386
TaqI TCGA 1 cut(s) 249
TasI AATT 1 cut(s) 268
Tru1I TTAA 3 cut(s) 258, 267, 438
Tru9I TTAA 3 cut(s) 258, 267, 438
TscAI CASTG 1 cut(s) 79
TspDTI ATGAA 4 cut(s) 17, 213, 222, 413
TspRI CASTG 1 cut(s) 79
XcmI CCANNNNNNNNNTGG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.