Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr00

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

42026067 .. 42030757

Gene Structure 4691 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD00G1178700.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 705 bp

ATGAATCCTAGAACGCCATTGCGCTCGGTTTTGTGTCATGTCCTCCGTTGGGCATGTTTGCTAGAGGTTGACACACCGGGACTTTCCAATTATCCAGCAGTGTGGGAGCTGCAAGCTTCACGTGTCTCAACTTTGTCAGAGAACTTTGGCAAAGTTATCTGTGGTACCCATGAGCTACTGTTGCGTTGGCCAGGAACCTTCTCACTCCCAAAGATAACAGACTACTTTCCAAACGGTCTGATGAGTTGGGCTGTTAAGGATTCTCTGGCTCTCAGTGTTCAGTGTGCAGGTTCTGTGTCTAATATGGCCCAACGCCTATTTGCTCGAACCCGCCAAGTTGAATCATTGGCGGCTGAAGTGATGAGTCTCAAACAGGAGATTAGAGGGCTCAAGCATGAGAATAAACAGTTGCACCGGCTCGCACATGACTATGCTACAAACATGAAGAGGAAGCTTGACCAGATGAAGGAATCTGATGGTCAGGTTTTACTTGATCATCAGAGATTTGTGGGTTTGTTCCAAAGGCATTTATTGCCTTCGTCTTCTGGGGCTGTACCGCTTAATGAAGCTCCAAATGATCAACCTCTGATGCCTCCTCCTTCTAGGGTTCTGTCCAGTACTGAGGCTCCGAATGATCCCCCTCCGGTGCCTTCTCTTTCTGGGGCTCTACCGACTGCTGAGACTTCTCCTAAGCAACCTTTCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

235

Amino Acids

25.94

Weight (kDa)

8.72

Isoelectric Point (pI)

57.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	278
Acc65I	GGTACC	1 cut(s)	164
AccB1I	GGYRCC	2 cut(s)	164, 646
AciI	CCGC	3 cut(s)	331, 350, 557
AclWI	GGATC	1 cut(s)	629
AcoI	YGGCCR	1 cut(s)	188
AcuI	CTGAAG	1 cut(s)	375
AcvI	CACGTG	1 cut(s)	122
AfaI	GTAC	3 cut(s)	166, 555, 619
AfiI	CCNNNNNNNGG	2 cut(s)	49, 466
AflIII	ACRYGT	1 cut(s)	121
AgsI	TTSAA	1 cut(s)	341
AjnI	CCWGG	1 cut(s)	190
AluBI	AGCT	5 cut(s)	109, 116, 175, 454, 569
AluI	AGCT	5 cut(s)	109, 116, 175, 454, 569
Alw26I	GTCTC	3 cut(s)	130, 371, 674
AlwI	GGATC	1 cut(s)	629
AlwNI	CAGNNNCTG	1 cut(s)	293
AoxI	GGCC	2 cut(s)	188, 306
ApeKI	GCWGC	1 cut(s)	109
Asp718I	GGTACC	1 cut(s)	164
AspLEI	GCGC	1 cut(s)	24
AspS9I	GGNCC	1 cut(s)	307
AsuC2I	CCSGG	1 cut(s)	78
BalI	TGGCCA	1 cut(s)	190
BanI	GGYRCC	2 cut(s)	164, 646
BanII	GRGCYC	2 cut(s)	390, 667
BbrPI	CACGTG	1 cut(s)	122
BbsI	GAAGAC	1 cut(s)	534
BbvI	GCAGC	1 cut(s)	96
BccI	CCATC	1 cut(s)	470
BciT130I	CCWGG	1 cut(s)	192
BclI	TGATCA	2 cut(s)	493, 577
BcnI	CCSGG	1 cut(s)	78
BcoDI	GTCTC	3 cut(s)	130, 371, 674
BfaI	CTAG	3 cut(s)	9, 62, 603
BfuAI	ACCTGC	1 cut(s)	278
BisI	GCNGC	2 cut(s)	110, 351
BlsI	GCNGC	2 cut(s)	111, 352
BmcAI	AGTACT	1 cut(s)	619
Bme1390I	CCNGG	2 cut(s)	78, 192
BmgT120I	GGNCC	1 cut(s)	307
BmiI	GGNNCC	4 cut(s)	166, 196, 627, 648
BmrFI	CCNGG	2 cut(s)	78, 192
BmsI	GCATC	1 cut(s)	579
BpiI	GAAGAC	1 cut(s)	534
Bpu10I	CCTNAGC	1 cut(s)	690
BpuEI	CTTGAG	1 cut(s)	374
BpuMI	CCSGG	1 cut(s)	78
BsaAI	YACGTR	1 cut(s)	122
BsaWI	WCCGGW	1 cut(s)	643
BsaXI	ACNNNNNCTCC	2 cut(s)	610, 640
Bsc4I	CCNNNNNNNGG	2 cut(s)	49, 466
Bse118I	RCCGGY	1 cut(s)	414
Bse1I	ACTGG	1 cut(s)	615
Bse3DI	GCAATG	1 cut(s)	17
BseBI	CCWGG	1 cut(s)	192
BseLI	CCNNNNNNNGG	2 cut(s)	49, 466
BseMI	GCAATG	1 cut(s)	17
BseMII	CTCAG	3 cut(s)	286, 612, 669
BseNI	ACTGG	1 cut(s)	615
BseRI	GAGGAG	1 cut(s)	585
BseXI	GCAGC	1 cut(s)	96
BsgI	GTGCAG	1 cut(s)	306
BshFI	GGCC	2 cut(s)	190, 308
BshNI	GGYRCC	2 cut(s)	164, 646
BsiSI	CCGG	3 cut(s)	77, 415, 644
BslFI	GGGAC	1 cut(s)	93
BslI	CCNNNNNNNGG	2 cut(s)	49, 466
BsmAI	GTCTC	3 cut(s)	130, 371, 674
BsmFI	GGGAC	1 cut(s)	93
BsnI	GGCC	2 cut(s)	190, 308
Bsp1286I	GDGCHC	2 cut(s)	390, 667
Bsp143I	GATC	3 cut(s)	493, 577, 634
BspACI	CCGC	3 cut(s)	331, 350, 557
BspANI	GGCC	2 cut(s)	190, 308
BspCNI	CTCAG	3 cut(s)	285, 613, 670
BspLI	GGNNCC	4 cut(s)	166, 196, 627, 648
BspMI	ACCTGC	1 cut(s)	278
BspPI	GGATC	1 cut(s)	629
BspT107I	GGYRCC	2 cut(s)	164, 646
BsrDI	GCAATG	1 cut(s)	17
BsrFI	RCCGGY	1 cut(s)	414
BsrI	ACTGG	1 cut(s)	615
BssAI	RCCGGY	1 cut(s)	414
BssMI	GATC	3 cut(s)	493, 577, 634
Bst2UI	CCWGG	1 cut(s)	192
Bst4CI	ACNGT	3 cut(s)	180, 236, 408
Bst6I	CTCTTC	1 cut(s)	440
BstAPI	GCANNNNNTGC	1 cut(s)	532
BstBAI	YACGTR	1 cut(s)	122
BstC8I	GCNNGC	2 cut(s)	114, 420
BstDEI	CTNAG	4 cut(s)	272, 621, 678, 690
BstHHI	GCGC	1 cut(s)	24
BstKTI	GATC	3 cut(s)	496, 580, 637
BstMAI	GTCTC	3 cut(s)	130, 371, 674
BstMBI	GATC	3 cut(s)	493, 577, 634
BstMWI	GCNNNNNNNGC	2 cut(s)	181, 532
BstNI	CCWGG	1 cut(s)	192
BstNSI	RCATGY	1 cut(s)	57
BstSCI	CCNGG	2 cut(s)	76, 190
BstV1I	GCAGC	1 cut(s)	96
BstV2I	GAAGAC	1 cut(s)	534
BstXI	CCANNNNNNTGG	1 cut(s)	102
BsuRI	GGCC	2 cut(s)	190, 308
BtsI	GCAGTG	1 cut(s)	105
BtsIMutI	CAGTG	3 cut(s)	105, 280, 287
BveI	ACCTGC	1 cut(s)	278
Cac8I	GCNNGC	2 cut(s)	114, 420
CaiI	CAGNNNCTG	1 cut(s)	293
CfoI	GCGC	1 cut(s)	24
Cfr10I	RCCGGY	1 cut(s)	414
Cfr13I	GGNCC	1 cut(s)	307
Csp6I	GTAC	3 cut(s)	165, 554, 618
CviAII	CATG	6 cut(s)	38, 54, 170, 395, 425, 442
CviQI	GTAC	3 cut(s)	165, 554, 618
DdeI	CTNAG	4 cut(s)	272, 621, 678, 690
DpnI	GATC	3 cut(s)	495, 579, 636
DpnII	GATC	3 cut(s)	493, 577, 634
EaeI	YGGCCR	1 cut(s)	188
Eam1104I	CTCTTC	1 cut(s)	440
EarI	CTCTTC	1 cut(s)	440
Eco24I	GRGCYC	2 cut(s)	390, 667
Eco57I	CTGAAG	1 cut(s)	375
Eco72I	CACGTG	1 cut(s)	122
EcoRII	CCWGG	1 cut(s)	190
EcoT38I	GRGCYC	2 cut(s)	390, 667
FaeI	CATG	6 cut(s)	41, 57, 173, 398, 428, 445
FaiI	YATR	8 cut(s)	39, 55, 171, 305, 396, 426, 432, 443
FaqI	GGGAC	1 cut(s)	93
FatI	CATG	6 cut(s)	37, 53, 169, 394, 424, 441
FauI	CCCGC	1 cut(s)	338
FbaI	TGATCA	2 cut(s)	493, 577
Fnu4HI	GCNGC	2 cut(s)	110, 351
FriOI	GRGCYC	2 cut(s)	390, 667
Fsp4HI	GCNGC	2 cut(s)	110, 351
FspBI	CTAG	3 cut(s)	9, 62, 603
GlaI	GCGC	1 cut(s)	23
GluI	GCNGC	2 cut(s)	110, 351
HaeIII	GGCC	2 cut(s)	190, 308
HapII	CCGG	3 cut(s)	77, 415, 644
HhaI	GCGC	1 cut(s)	24
Hin1II	CATG	6 cut(s)	41, 57, 173, 398, 428, 445
Hin6I	GCGC	1 cut(s)	22
HinP1I	GCGC	1 cut(s)	22
HincII	GTYRAC	1 cut(s)	70
HindII	GTYRAC	1 cut(s)	70
HindIII	AAGCTT	2 cut(s)	114, 452
HinfI	GANTC	5 cut(s)	4, 260, 341, 364, 470
HpaII	CCGG	3 cut(s)	77, 415, 644
Hpy166II	GTNNAC	1 cut(s)	70
Hpy188I	TCNGA	6 cut(s)	139, 240, 475, 501, 588, 630
Hpy8I	GTNNAC	1 cut(s)	70
HpyAV	CCTTC	5 cut(s)	208, 460, 546, 609, 660
HpyCH4III	ACNGT	3 cut(s)	180, 236, 408
HpyCH4IV	ACGT	1 cut(s)	121
HpyCH4V	TGCA	3 cut(s)	112, 287, 412
HpyF10VI	GCNNNNNNNGC	2 cut(s)	181, 532
HpyF3I	CTNAG	4 cut(s)	272, 621, 678, 690
HpySE526I	ACGT	1 cut(s)	121
Hsp92II	CATG	6 cut(s)	41, 57, 173, 398, 428, 445
HspAI	GCGC	1 cut(s)	22
KpnI	GGTACC	1 cut(s)	168
Ksp22I	TGATCA	2 cut(s)	493, 577
Kzo9I	GATC	3 cut(s)	493, 577, 634
LmnI	GCTCC	3 cut(s)	106, 574, 631
Lsp1109I	GCAGC	1 cut(s)	96
LweI	GCATC	1 cut(s)	579
MaeI	CTAG	3 cut(s)	9, 62, 603
MaeII	ACGT	1 cut(s)	121
MalI	GATC	3 cut(s)	495, 579, 636
MboI	GATC	3 cut(s)	493, 577, 634
MboII	GAAGA	2 cut(s)	457, 534
MhlI	GDGCHC	2 cut(s)	390, 667
MlsI	TGGCCA	1 cut(s)	190
MluCI	AATT	1 cut(s)	88
MluNI	TGGCCA	1 cut(s)	190
MlyI	GAGTC	1 cut(s)	373
MnlI	CCTC	9 cut(s)	53, 58, 377, 441, 594, 603, 606, 616, 651
Mox20I	TGGCCA	1 cut(s)	190
MscI	TGGCCA	1 cut(s)	190
MseI	TTAA	2 cut(s)	255, 561
MslI	CAYNNNNRTG	1 cut(s)	429
Msp20I	TGGCCA	1 cut(s)	190
MspI	CCGG	3 cut(s)	77, 415, 644
MspR9I	CCNGG	2 cut(s)	78, 192
MvaI	CCWGG	1 cut(s)	192
MwoI	GCNNNNNNNGC	2 cut(s)	181, 532
NciI	CCSGG	1 cut(s)	78
NdeII	GATC	3 cut(s)	493, 577, 634
NlaIII	CATG	6 cut(s)	41, 57, 173, 398, 428, 445
NlaIV	GGNNCC	4 cut(s)	166, 196, 627, 648
NspI	RCATGY	1 cut(s)	57
PfeI	GAWTC	4 cut(s)	4, 260, 341, 470
PkrI	GCNGC	2 cut(s)	111, 352
PleI	GAGTC	1 cut(s)	372
PmaCI	CACGTG	1 cut(s)	122
PmlI	CACGTG	1 cut(s)	122
PpsI	GAGTC	1 cut(s)	372
Ppu21I	YACGTR	1 cut(s)	122
Psp6I	CCWGG	1 cut(s)	190
PspCI	CACGTG	1 cut(s)	122
PspGI	CCWGG	1 cut(s)	190
PspN4I	GGNNCC	4 cut(s)	166, 196, 627, 648
PspPI	GGNCC	1 cut(s)	307
PstNI	CAGNNNCTG	1 cut(s)	293
RsaI	GTAC	3 cut(s)	166, 555, 619
RsaNI	GTAC	3 cut(s)	165, 554, 618
RseI	CAYNNNNRTG	1 cut(s)	429
SaqAI	TTAA	2 cut(s)	255, 561
SatI	GCNGC	2 cut(s)	110, 351
Sau3AI	GATC	3 cut(s)	493, 577, 634
Sau96I	GGNCC	1 cut(s)	307
ScaI	AGTACT	1 cut(s)	619
SchI	GAGTC	1 cut(s)	373
ScrFI	CCNGG	2 cut(s)	78, 192
SduI	GDGCHC	2 cut(s)	390, 667
SfaNI	GCATC	1 cut(s)	579
SmiMI	CAYNNNNRTG	1 cut(s)	429
SmlI	CTYRAG	1 cut(s)	389
SmoI	CTYRAG	1 cut(s)	389
Sse9I	AATT	1 cut(s)	88
SsiI	CCGC	3 cut(s)	331, 350, 557
SspMI	CTAG	3 cut(s)	9, 62, 603
StyD4I	CCNGG	2 cut(s)	76, 190
TaaI	ACNGT	3 cut(s)	180, 236, 408
TaiI	ACGT	1 cut(s)	124
TaqI	TCGA	1 cut(s)	325
TasI	AATT	1 cut(s)	88
TatI	WGTACW	1 cut(s)	617
TauI	GCSGC	1 cut(s)	353
TfiI	GAWTC	4 cut(s)	4, 260, 341, 470
Tru1I	TTAA	2 cut(s)	255, 561
Tru9I	TTAA	2 cut(s)	255, 561
TscAI	CASTG	3 cut(s)	105, 280, 287
TseI	GCWGC	1 cut(s)	109
TspDTI	ATGAA	4 cut(s)	17, 458, 479, 579
TspGWI	ACGGA	1 cut(s)	35
TspRI	CASTG	3 cut(s)	105, 280, 287
XceI	RCATGY	1 cut(s)	57
XspI	CTAG	3 cut(s)	9, 62, 603
ZrmI	AGTACT	1 cut(s)	619

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.