Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr13

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

15244777 .. 15245529

Gene Structure 753 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom13g19230.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 753 bp

ATGTCGCTTGGCTTTTTACAGAGGTATCGATCACTCCAACATACACACTCTGAAAATTGCCCATTCTTGAAAATCGTCTCCGGCCTTTTGAGAATTATCTTCATCCACCCATTCTCTCTGAACACCTTTGAAAAAATGACTAACTCATCGAACCTTTGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCACCCGGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTACAGGTGAAGACTCCGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTCAGCGTTCAGTGTGCAGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGCTCCCGTCAGGTTGAATCGTTGATGGCAGAGGTGGAAAGTCTCAAGCAAGAGATCAAGCAGCTGAAGTATGAGAATAGAAGTTTGCACGTGCTTGCAAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACATTTTTCCTGGGTCTTCCAGCGTTTGGCCAAGTATTGAGGCCTCGAATGCTCTATCTTCGATGCCTCCCGCTCCTGGAGTTTTGCCACGTAGTGGGGCTTCACGTGAACATCCTTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

251

Amino Acids

27.61

Weight (kDa)

8.86

Isoelectric Point (pI)

61.81

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	213
AccB7I	CCANNNNNTGG	2 cut(s)	657, 725
AccBSI	CCGCTC	1 cut(s)	704
AciI	CCGC	1 cut(s)	702
AclWI	GGATC	1 cut(s)	176
AcoI	YGGCCR	2 cut(s)	354, 659
AcuI	CTGAAG	2 cut(s)	515, 600
AcvI	CACGTG	2 cut(s)	520, 737
AcyI	GRCGYC	2 cut(s)	214, 273
AdeI	CACNNNGTG	1 cut(s)	725
AfiI	CCNNNNNNNGG	5 cut(s)	200, 248, 657, 707, 725
AgsI	TTSAA	5 cut(s)	70, 131, 362, 446, 593
AjnI	CCWGG	2 cut(s)	640, 706
AluBI	AGCT	5 cut(s)	284, 296, 493, 559, 568
AluI	AGCT	5 cut(s)	284, 296, 493, 559, 568
Alw26I	GTCTC	3 cut(s)	82, 176, 476
AlwI	GGATC	1 cut(s)	176
AlwNI	CAGNNNCTG	1 cut(s)	398
AoxI	GGCC	5 cut(s)	82, 354, 412, 659, 672
ApeKI	GCWGC	4 cut(s)	177, 328, 490, 568
ArsI	GACNNNNNNTTYG	2 cut(s)	586, 618
AspLEI	GCGC	1 cut(s)	216
AspS9I	GGNCC	3 cut(s)	239, 342, 412
AsuC2I	CCSGG	1 cut(s)	195
AsuHPI	GGTGA	1 cut(s)	263
AvaII	GGWCC	2 cut(s)	239, 342
BaeI	ACNNNNGTAYC	2 cut(s)	8, 41
BalI	TGGCCA	1 cut(s)	661
BanI	GGYRCC	1 cut(s)	213
BarI	GAAGNNNNNNTAC	2 cut(s)	715, 747
BbrPI	CACGTG	2 cut(s)	520, 737
BbsI	GAAGAC	2 cut(s)	261, 639
BbvI	GCAGC	4 cut(s)	189, 315, 502, 555
BccI	CCATC	1 cut(s)	448
BceAI	ACGGC	1 cut(s)	341
BcgI	CGANNNNNNTGC	2 cut(s)	170, 204
BciT130I	CCWGG	2 cut(s)	642, 708
BcnI	CCSGG	1 cut(s)	195
BcoDI	GTCTC	3 cut(s)	82, 176, 476
BfaI	CTAG	1 cut(s)	297
BfoI	RGCGCY	1 cut(s)	217
BisI	GCNGC	4 cut(s)	178, 329, 491, 569
BlsI	GCNGC	4 cut(s)	179, 330, 492, 570
Bme1390I	CCNGG	3 cut(s)	195, 642, 708
Bme18I	GGWCC	2 cut(s)	239, 342
BmgT120I	GGNCC	3 cut(s)	239, 342, 412
BmiI	GGNNCC	2 cut(s)	215, 302
BmrFI	CCNGG	3 cut(s)	195, 642, 708
BmsI	GCATC	2 cut(s)	255, 684
BpiI	GAAGAC	2 cut(s)	261, 639
BpmI	CTGGAG	2 cut(s)	608, 729
BpuEI	CTTGAG	1 cut(s)	458
BpuMI	CCSGG	1 cut(s)	195
Bsa29I	ATCGAT	1 cut(s)	28
BsaAI	YACGTR	3 cut(s)	520, 722, 737
BsaHI	GRCGYC	2 cut(s)	214, 273
BsaJI	CCNNGG	1 cut(s)	641
BsaWI	WCCGGW	1 cut(s)	184
Bsc4I	CCNNNNNNNGG	5 cut(s)	200, 248, 657, 707, 725
BseBI	CCWGG	2 cut(s)	642, 708
BseCI	ATCGAT	1 cut(s)	28
BseDI	CCNNGG	1 cut(s)	641
BseGI	GGATG	2 cut(s)	102, 742
BseLI	CCNNNNNNNGG	5 cut(s)	200, 248, 657, 707, 725
BseMII	CTCAG	2 cut(s)	187, 391
BseRI	GAGGAG	1 cut(s)	296
BseXI	GCAGC	4 cut(s)	189, 315, 502, 555
BsgI	GTGCAG	1 cut(s)	411
BshFI	GGCC	5 cut(s)	84, 356, 414, 661, 674
BshNI	GGYRCC	1 cut(s)	213
BshVI	ATCGAT	1 cut(s)	28
BsiSI	CCGG	3 cut(s)	81, 185, 195
BslFI	GGGAC	1 cut(s)	352
BslI	CCNNNNNNNGG	5 cut(s)	200, 248, 657, 707, 725
BsmAI	GTCTC	3 cut(s)	82, 176, 476
BsmBI	CGTCTC	1 cut(s)	82
BsmFI	GGGAC	1 cut(s)	352
BsmI	GAATGC	1 cut(s)	685
BsnI	GGCC	5 cut(s)	84, 356, 414, 661, 674
Bsp143I	GATC	3 cut(s)	29, 181, 483
BspACI	CCGC	1 cut(s)	702
BspANI	GGCC	5 cut(s)	84, 356, 414, 661, 674
BspCNI	CTCAG	2 cut(s)	186, 390
BspDI	ATCGAT	1 cut(s)	28
BspLI	GGNNCC	2 cut(s)	215, 302
BspPI	GGATC	1 cut(s)	176
BspT107I	GGYRCC	1 cut(s)	213
BsrBI	CCGCTC	1 cut(s)	704
BssECI	CCNNGG	1 cut(s)	641
BssMI	GATC	3 cut(s)	29, 181, 483
BssNI	GRCGYC	2 cut(s)	214, 273
Bst2UI	CCWGG	2 cut(s)	642, 708
Bst4CI	ACNGT	3 cut(s)	239, 342, 602
Bst6I	CTCTTC	1 cut(s)	545
BstACI	GRCGYC	2 cut(s)	214, 273
BstBAI	YACGTR	3 cut(s)	520, 722, 737
BstC8I	GCNNGC	3 cut(s)	394, 430, 525
BstDEI	CTNAG	3 cut(s)	160, 173, 377
BstENI	CCTNNNNNAGG	1 cut(s)	246
BstF5I	GGATG	2 cut(s)	102, 742
BstH2I	RGCGCY	1 cut(s)	217
BstHHI	GCGC	1 cut(s)	216
BstKTI	GATC	3 cut(s)	32, 184, 486
BstMAI	GTCTC	3 cut(s)	82, 176, 476
BstMBI	GATC	3 cut(s)	29, 181, 483
BstMWI	GCNNNNNNNGC	3 cut(s)	281, 565, 680
BstNI	CCWGG	2 cut(s)	642, 708
BstSCI	CCNGG	3 cut(s)	193, 640, 706
BstV1I	GCAGC	4 cut(s)	189, 315, 502, 555
BstV2I	GAAGAC	2 cut(s)	261, 639
Bsu15I	ATCGAT	1 cut(s)	28
BsuRI	GGCC	5 cut(s)	84, 356, 414, 661, 674
BsuTUI	ATCGAT	1 cut(s)	28
BtsCI	GGATG	2 cut(s)	102, 742
BtsIMutI	CAGTG	1 cut(s)	392
Cac8I	GCNNGC	3 cut(s)	394, 430, 525
CaiI	CAGNNNCTG	1 cut(s)	398
CfoI	GCGC	1 cut(s)	216
Cfr13I	GGNCC	3 cut(s)	239, 342, 412
ClaI	ATCGAT	1 cut(s)	28
CpoI	CGGWCCG	1 cut(s)	342
CseI	GACGC	1 cut(s)	281
CspI	CGGWCCG	1 cut(s)	342
CviAII	CATG	2 cut(s)	409, 547
DdeI	CTNAG	3 cut(s)	160, 173, 377
DinI	GGCGCC	1 cut(s)	215
DpnI	GATC	3 cut(s)	31, 183, 485
DpnII	GATC	3 cut(s)	29, 181, 483
DraIII	CACNNNGTG	1 cut(s)	725
EaeI	YGGCCR	2 cut(s)	354, 659
Eam1104I	CTCTTC	1 cut(s)	545
EarI	CTCTTC	1 cut(s)	545
Eco147I	AGGCCT	1 cut(s)	674
Eco47I	GGWCC	2 cut(s)	239, 342
Eco57I	CTGAAG	2 cut(s)	515, 600
Eco72I	CACGTG	2 cut(s)	520, 737
EcoNI	CCTNNNNNAGG	1 cut(s)	246
EcoRII	CCWGG	2 cut(s)	640, 706
EgeI	GGCGCC	1 cut(s)	215
EheI	GGCGCC	1 cut(s)	215
Esp3I	CGTCTC	1 cut(s)	82
FaeI	CATG	2 cut(s)	412, 550
FaiI	YATR	5 cut(s)	42, 211, 410, 501, 548
FaqI	GGGAC	1 cut(s)	352
FatI	CATG	2 cut(s)	408, 546
FauI	CCCGC	1 cut(s)	709
Fnu4HI	GCNGC	4 cut(s)	178, 329, 491, 569
FokI	GGATG	2 cut(s)	89, 729
Fsp4HI	GCNGC	4 cut(s)	178, 329, 491, 569
FspBI	CTAG	1 cut(s)	297
GlaI	GCGC	1 cut(s)	215
GluI	GCNGC	4 cut(s)	178, 329, 491, 569
GsuI	CTGGAG	2 cut(s)	608, 729
HaeII	RGCGCY	1 cut(s)	217
HaeIII	GGCC	5 cut(s)	84, 356, 414, 661, 674
HapII	CCGG	3 cut(s)	81, 185, 195
HgaI	GACGC	1 cut(s)	281
HhaI	GCGC	1 cut(s)	216
Hin1I	GRCGYC	2 cut(s)	214, 273
Hin1II	CATG	2 cut(s)	412, 550
Hin6I	GCGC	1 cut(s)	214
HinP1I	GCGC	1 cut(s)	214
HindIII	AAGCTT	1 cut(s)	557
HinfI	GANTC	6 cut(s)	169, 257, 365, 446, 575, 589
HpaII	CCGG	3 cut(s)	81, 185, 195
HphI	GGTGA	1 cut(s)	263
Hpy166II	GTNNAC	1 cut(s)	740
Hpy188I	TCNGA	5 cut(s)	52, 120, 346, 580, 588
Hpy188III	TCNNGA	4 cut(s)	67, 336, 362, 625
Hpy8I	GTNNAC	1 cut(s)	740
Hpy99I	CGWCG	1 cut(s)	544
HpyAV	CCTTC	2 cut(s)	228, 575
HpyCH4III	ACNGT	3 cut(s)	239, 342, 602
HpyCH4IV	ACGT	3 cut(s)	519, 721, 736
HpyCH4V	TGCA	6 cut(s)	191, 268, 392, 517, 527, 571
HpyF10VI	GCNNNNNNNGC	3 cut(s)	281, 565, 680
HpyF3I	CTNAG	3 cut(s)	160, 173, 377
HpySE526I	ACGT	3 cut(s)	519, 721, 736
Hsp92I	GRCGYC	2 cut(s)	214, 273
Hsp92II	CATG	2 cut(s)	412, 550
HspAI	GCGC	1 cut(s)	214
KasI	GGCGCC	1 cut(s)	213
Kzo9I	GATC	3 cut(s)	29, 181, 483
LmnI	GCTCC	2 cut(s)	437, 709
Lsp1109I	GCAGC	4 cut(s)	189, 315, 502, 555
LweI	GCATC	2 cut(s)	255, 684
MaeI	CTAG	1 cut(s)	297
MaeII	ACGT	3 cut(s)	519, 721, 736
MaeIII	GTNAC	1 cut(s)	596
MalI	GATC	3 cut(s)	31, 183, 485
MbiI	CCGCTC	1 cut(s)	704
MboI	GATC	3 cut(s)	29, 181, 483
MboII	GAAGA	6 cut(s)	91, 222, 266, 562, 639, 681
MlsI	TGGCCA	1 cut(s)	661
MluCI	AATT	2 cut(s)	55, 93
MluNI	TGGCCA	1 cut(s)	661
Mly113I	GGCGCC	1 cut(s)	214
MlyI	GAGTC	4 cut(s)	178, 251, 374, 584
MmeI	TCCRAC	3 cut(s)	61, 429, 566
Mox20I	TGGCCA	1 cut(s)	661
MscI	TGGCCA	1 cut(s)	661
Msp20I	TGGCCA	1 cut(s)	661
MspA1I	CMGCKG	1 cut(s)	493
MspI	CCGG	3 cut(s)	81, 185, 195
MspR9I	CCNGG	3 cut(s)	195, 642, 708
Mva1269I	GAATGC	1 cut(s)	685
MvaI	CCWGG	2 cut(s)	642, 708
MwoI	GCNNNNNNNGC	3 cut(s)	281, 565, 680
NarI	GGCGCC	1 cut(s)	214
NciI	CCSGG	1 cut(s)	195
NdeII	GATC	3 cut(s)	29, 181, 483
NlaIII	CATG	2 cut(s)	412, 550
NlaIV	GGNNCC	2 cut(s)	215, 302
NmuCI	GTSAC	1 cut(s)	596
PceI	AGGCCT	1 cut(s)	674
PcsI	WCGNNNNNNNCGW	1 cut(s)	378
PctI	GAATGC	1 cut(s)	685
PfeI	GAWTC	2 cut(s)	446, 589
PflMI	CCANNNNNTGG	2 cut(s)	657, 725
PfoI	TCCNGGA	1 cut(s)	706
PkrI	GCNGC	4 cut(s)	179, 330, 492, 570
PleI	GAGTC	4 cut(s)	177, 251, 373, 583
PluTI	GGCGCC	1 cut(s)	217
PmaCI	CACGTG	2 cut(s)	520, 737
PmlI	CACGTG	2 cut(s)	520, 737
PpsI	GAGTC	4 cut(s)	177, 251, 373, 583
Ppu21I	YACGTR	3 cut(s)	520, 722, 737
Psp6I	CCWGG	2 cut(s)	640, 706
PspCI	CACGTG	2 cut(s)	520, 737
PspGI	CCWGG	2 cut(s)	640, 706
PspN4I	GGNNCC	2 cut(s)	215, 302
PspPI	GGNCC	3 cut(s)	239, 342, 412
PstNI	CAGNNNCTG	1 cut(s)	398
PvuII	CAGCTG	1 cut(s)	493
Rsr2I	CGGWCCG	1 cut(s)	342
RsrII	CGGWCCG	1 cut(s)	342
SatI	GCNGC	4 cut(s)	178, 329, 491, 569
Sau3AI	GATC	3 cut(s)	29, 181, 483
Sau96I	GGNCC	3 cut(s)	239, 342, 412
SchI	GAGTC	4 cut(s)	178, 251, 374, 584
ScrFI	CCNGG	3 cut(s)	195, 642, 708
SfaNI	GCATC	2 cut(s)	255, 684
SfoI	GGCGCC	1 cut(s)	215
SinI	GGWCC	2 cut(s)	239, 342
SmlI	CTYRAG	1 cut(s)	473
SmoI	CTYRAG	1 cut(s)	473
Sse9I	AATT	2 cut(s)	55, 93
SseBI	AGGCCT	1 cut(s)	674
SsiI	CCGC	1 cut(s)	702
SspDI	GGCGCC	1 cut(s)	213
SspMI	CTAG	1 cut(s)	297
StuI	AGGCCT	1 cut(s)	674
StyD4I	CCNGG	3 cut(s)	193, 640, 706
TaaI	ACNGT	3 cut(s)	239, 342, 602
TaiI	ACGT	3 cut(s)	522, 724, 739
TaqI	TCGA	5 cut(s)	28, 149, 539, 677, 692
TasI	AATT	2 cut(s)	55, 93
TfiI	GAWTC	2 cut(s)	446, 589
TscAI	CASTG	1 cut(s)	392
TseFI	GTSAC	1 cut(s)	596
TseI	GCWGC	4 cut(s)	177, 328, 490, 568
Tsp45I	GTSAC	1 cut(s)	596
TspDTI	ATGAA	2 cut(s)	91, 563
TspGWI	ACGGA	1 cut(s)	250
TspRI	CASTG	1 cut(s)	392
Van91I	CCANNNNNTGG	2 cut(s)	657, 725
VpaK11BI	GGWCC	2 cut(s)	239, 342
XagI	CCTNNNNNAGG	1 cut(s)	246
XspI	CTAG	1 cut(s)	297

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.