pycom05g01110

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0000120
Physical Location & Seq
Forward (+)
1346995 .. 1347393
399 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g01110.3

Sequence Viewer

Length: 243 bp
ATGCAGGGGAAGGCGTCGCGCTCCGGTGGTGCGCAACCCTTTGCCTTTAAATGGTCTTTCAGGGCATCACTTCTCAGCAATTCATCCATTCTTGGCAGCTTCAGTGTAAAGAGCCGACACTCCGTCACCTGTCCTGAAGTATGCGCTGAGGGAACTCGAGACTCACCAACAGTTGAAGATGAGCACCCGAGAGCAACGTTAGGCAAGAGCAAGGGCAAAGGAAAAGATAGGGAAAAAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.57

Weight (kDa)

9.83

Isoelectric Point (pI)

32.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 33
AccII CGCG 1 cut(s) 19
AclI AACGTT 1 cut(s) 197
AcuI CTGAAG 2 cut(s) 85, 156
AcyI GRCGYC 1 cut(s) 14
AfiI CCNNNNNNNGG 1 cut(s) 51
AgsI TTSAA 1 cut(s) 176
AhdI GACNNNNNGTC 1 cut(s) 122
AluBI AGCT 1 cut(s) 99
AluI AGCT 1 cut(s) 99
Alw21I GWGCWC 1 cut(s) 186
Alw26I GTCTC 1 cut(s) 153
Ama87I CYCGRG 2 cut(s) 156, 187
ApeKI GCWGC 1 cut(s) 96
AspLEI GCGC 3 cut(s) 21, 34, 146
AsuHPI GGTGA 2 cut(s) 118, 156
AvaI CYCGRG 2 cut(s) 156, 187
Bbv12I GWGCWC 1 cut(s) 186
BbvCI CCTCAGC 1 cut(s) 147
BbvI GCAGC 1 cut(s) 108
BcoDI GTCTC 1 cut(s) 153
BisI GCNGC 1 cut(s) 97
BlsI GCNGC 1 cut(s) 98
BmeRI GACNNNNNGTC 1 cut(s) 122
BmeT110I CYCGRG 2 cut(s) 156, 187
BmsI GCATC 1 cut(s) 74
Bpu10I CCTNAGC 1 cut(s) 147
BsaHI GRCGYC 1 cut(s) 14
BsaWI WCCGGW 1 cut(s) 23
Bsc4I CCNNNNNNNGG 1 cut(s) 51
BseGI GGATG 1 cut(s) 83
BseLI CCNNNNNNNGG 1 cut(s) 51
BseMII CTCAG 2 cut(s) 88, 138
BseXI GCAGC 1 cut(s) 108
Bsh1236I CGCG 1 cut(s) 19
BsiHKAI GWGCWC 1 cut(s) 186
BsiHKCI CYCGRG 2 cut(s) 156, 187
BsiSI CCGG 1 cut(s) 24
BslI CCNNNNNNNGG 1 cut(s) 51
BsmAI GTCTC 1 cut(s) 153
BsoBI CYCGRG 2 cut(s) 156, 187
Bsp1286I GDGCHC 1 cut(s) 186
BspCNI CTCAG 2 cut(s) 87, 139
BspFNI CGCG 1 cut(s) 19
BssNI GRCGYC 1 cut(s) 14
Bst4CI ACNGT 1 cut(s) 172
BstACI GRCGYC 1 cut(s) 14
BstDEI CTNAG 2 cut(s) 74, 147
BstF5I GGATG 1 cut(s) 83
BstFNI CGCG 1 cut(s) 19
BstHHI GCGC 3 cut(s) 21, 34, 146
BstMAI GTCTC 1 cut(s) 153
BstUI CGCG 1 cut(s) 19
BstV1I GCAGC 1 cut(s) 108
BtsCI GGATG 1 cut(s) 83
BtsIMutI CAGTG 1 cut(s) 109
CfoI GCGC 3 cut(s) 21, 34, 146
CseI GACGC 1 cut(s) 3
CviAII CATG 1 cut(s) 240
CviJI RGCY 2 cut(s) 99, 114
CviKI_1 RGCY 2 cut(s) 99, 114
DdeI CTNAG 2 cut(s) 74, 147
DraI TTTAAA 1 cut(s) 49
DriI GACNNNNNGTC 1 cut(s) 122
Eam1105I GACNNNNNGTC 1 cut(s) 122
Eco57I CTGAAG 2 cut(s) 85, 156
Eco88I CYCGRG 2 cut(s) 156, 187
FaeI CATG 1 cut(s) 243
FaiI YATR 2 cut(s) 142, 241
FatI CATG 1 cut(s) 239
Fnu4HI GCNGC 1 cut(s) 97
FokI GGATG 1 cut(s) 70
Fsp4HI GCNGC 1 cut(s) 97
FspI TGCGCA 1 cut(s) 33
GlaI GCGC 3 cut(s) 20, 33, 145
GluI GCNGC 1 cut(s) 97
HapII CCGG 1 cut(s) 24
HgaI GACGC 1 cut(s) 3
HhaI GCGC 3 cut(s) 21, 34, 146
Hin1I GRCGYC 1 cut(s) 14
Hin1II CATG 1 cut(s) 243
Hin6I GCGC 3 cut(s) 19, 32, 144
HinP1I GCGC 3 cut(s) 19, 32, 144
HinfI GANTC 1 cut(s) 161
HpaII CCGG 1 cut(s) 24
HphI GGTGA 2 cut(s) 118, 156
Hpy188III TCNNGA 2 cut(s) 134, 158
Hpy99I CGWCG 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 4
HpyCH4III ACNGT 1 cut(s) 172
HpyCH4IV ACGT 1 cut(s) 197
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 2 cut(s) 74, 147
HpySE526I ACGT 1 cut(s) 197
Hsp92I GRCGYC 1 cut(s) 14
Hsp92II CATG 1 cut(s) 243
HspAI GCGC 3 cut(s) 19, 32, 144
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 4 cut(s) 37, 46, 142, 147
Lsp1109I GCAGC 1 cut(s) 108
LweI GCATC 1 cut(s) 74
MaeII ACGT 1 cut(s) 197
MaeIII GTNAC 1 cut(s) 124
MboII GAAGA 1 cut(s) 188
MhlI GDGCHC 1 cut(s) 186
MluCI AATT 1 cut(s) 79
MlyI GAGTC 1 cut(s) 155
MnlI CCTC 1 cut(s) 142
MseI TTAA 1 cut(s) 48
MspI CCGG 1 cut(s) 24
MvnI CGCG 1 cut(s) 19
NlaIII CATG 1 cut(s) 243
NmuCI GTSAC 1 cut(s) 124
NsbI TGCGCA 1 cut(s) 33
PaeR7I CTCGAG 1 cut(s) 156
PkrI GCNGC 1 cut(s) 98
PleI GAGTC 1 cut(s) 155
PpsI GAGTC 1 cut(s) 155
Psp1406I AACGTT 1 cut(s) 197
SaqAI TTAA 1 cut(s) 48
SatI GCNGC 1 cut(s) 97
SchI GAGTC 1 cut(s) 155
SduI GDGCHC 1 cut(s) 186
SetI ASST 3 cut(s) 101, 131, 200
SfaNI GCATC 1 cut(s) 74
Sfr274I CTCGAG 1 cut(s) 156
SlaI CTCGAG 1 cut(s) 156
SmlI CTYRAG 1 cut(s) 156
SmoI CTYRAG 1 cut(s) 156
Sse9I AATT 1 cut(s) 79
TaaI ACNGT 1 cut(s) 172
TaiI ACGT 1 cut(s) 200
TaqI TCGA 1 cut(s) 157
TasI AATT 1 cut(s) 79
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TscAI CASTG 1 cut(s) 109
TseFI GTSAC 1 cut(s) 124
TseI GCWGC 1 cut(s) 96
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 72
TspGWI ACGGA 1 cut(s) 112
TspRI CASTG 1 cut(s) 109
XhoI CTCGAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.