pycom1739g00060

Zinc finger MYM-type protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001739
OG0000120
Physical Location & Seq
Forward (+)
185514 .. 186026
513 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom1739g00060.2

Sequence Viewer

Length: 390 bp
ATGATTCAGGCATCCAATCTTGAATTTAAACCATTACCGGAACATTTCAAGTATCACCGCCCATTCAAAGATAAATTCCATAATAATAATAATAATAATAAAGCAGATGTAGCCTTCACAGAGGTTGTTTGCTTGAGGCCCCACTACGTGGCATCGGAGCGGGAGGCATCGGAGCTAGAGCATTCCAGGCCTCAATACTTGGCCAAATGCTGGATGACCCAGGAAAAAGGTGCCTCTGGAGATAAGCTGAAAACCTCTGACGGTCGCTTTGAATCCGACCTTCAGACTCTTGCAGCTCATCAAGCTTCCTCTTCATGCCCGACGAATAGTTATTTGCAAGCACATGCAAACTTCTATTCTCATACTTCAGCTGCTGGACCTCCTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

130

Amino Acids

14.52

Weight (kDa)

7.09

Isoelectric Point (pI)

45.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 230
AccB7I CCANNNNNTGG 2 cut(s) 148, 210
AccBSI CCGCTC 1 cut(s) 160
AciI CCGC 2 cut(s) 58, 160
AcoI YGGCCR 1 cut(s) 201
AcsI RAATTY 2 cut(s) 23, 74
AcuI CTGAAG 2 cut(s) 266, 351
AdeI CACNNNGTG 1 cut(s) 148
AfiI CCNNNNNNNGG 2 cut(s) 148, 210
AgsI TTSAA 4 cut(s) 23, 49, 67, 272
AjnI CCWGG 2 cut(s) 185, 219
AluBI AGCT 5 cut(s) 175, 247, 296, 305, 371
AluI AGCT 5 cut(s) 175, 247, 296, 305, 371
AlwNI CAGNNNCTG 1 cut(s) 374
AoxI GGCC 3 cut(s) 137, 188, 201
ApeKI GCWGC 2 cut(s) 293, 371
ApoI RAATTY 2 cut(s) 23, 74
ArsI GACNNNNNNTTYG 2 cut(s) 251, 283
AspS9I GGNCC 2 cut(s) 138, 377
AsuHPI GGTGA 1 cut(s) 47
AvaII GGWCC 1 cut(s) 377
BalI TGGCCA 1 cut(s) 203
BanI GGYRCC 1 cut(s) 230
BbvI GCAGC 2 cut(s) 305, 358
BciT130I CCWGG 2 cut(s) 187, 221
BfaI CTAG 1 cut(s) 176
BisI GCNGC 2 cut(s) 294, 372
BlsI GCNGC 2 cut(s) 295, 373
Bme1390I CCNGG 2 cut(s) 187, 221
Bme18I GGWCC 1 cut(s) 377
BmgT120I GGNCC 2 cut(s) 138, 377
BmiI GGNNCC 2 cut(s) 140, 232
BmrFI CCNGG 2 cut(s) 187, 221
BmsI GCATC 3 cut(s) 20, 161, 176
BpmI CTGGAG 1 cut(s) 258
BpuEI CTTGAG 1 cut(s) 154
BsaAI YACGTR 1 cut(s) 148
BsaJI CCNNGG 1 cut(s) 219
BsaWI WCCGGW 1 cut(s) 37
Bsc4I CCNNNNNNNGG 2 cut(s) 148, 210
BseBI CCWGG 2 cut(s) 187, 221
BseDI CCNNGG 1 cut(s) 219
BseGI GGATG 2 cut(s) 11, 219
BseLI CCNNNNNNNGG 2 cut(s) 148, 210
BseXI GCAGC 2 cut(s) 305, 358
Bsh1285I CGRYCG 1 cut(s) 265
BshFI GGCC 3 cut(s) 139, 190, 203
BshNI GGYRCC 1 cut(s) 230
BsiEI CGRYCG 1 cut(s) 265
BsiSI CCGG 1 cut(s) 38
BslI CCNNNNNNNGG 2 cut(s) 148, 210
BsmI GAATGC 1 cut(s) 181
BsnI GGCC 3 cut(s) 139, 190, 203
BspACI CCGC 2 cut(s) 58, 160
BspANI GGCC 3 cut(s) 139, 190, 203
BspLI GGNNCC 2 cut(s) 140, 232
BspT107I GGYRCC 1 cut(s) 230
BsrBI CCGCTC 1 cut(s) 160
BssECI CCNNGG 1 cut(s) 219
Bst2UI CCWGG 2 cut(s) 187, 221
Bst4CI ACNGT 1 cut(s) 263
Bst6I CTCTTC 1 cut(s) 316
BstBAI YACGTR 1 cut(s) 148
BstC8I GCNNGC 1 cut(s) 339
BstF5I GGATG 2 cut(s) 11, 219
BstMCI CGRYCG 1 cut(s) 265
BstMWI GCNNNNNNNGC 3 cut(s) 110, 187, 302
BstNI CCWGG 2 cut(s) 187, 221
BstNSI RCATGY 1 cut(s) 347
BstSCI CCNGG 2 cut(s) 185, 219
BstV1I GCAGC 2 cut(s) 305, 358
BsuRI GGCC 3 cut(s) 139, 190, 203
BtsCI GGATG 2 cut(s) 11, 219
Cac8I GCNNGC 1 cut(s) 339
CaiI CAGNNNCTG 1 cut(s) 374
Cfr13I GGNCC 2 cut(s) 138, 377
CviAII CATG 2 cut(s) 315, 344
CviJI RGCY 9 cut(s) 113, 139, 175, 190, 203, 247, 296, 305, 371
CviKI_1 RGCY 9 cut(s) 113, 139, 175, 190, 203, 247, 296, 305, 371
DraI TTTAAA 1 cut(s) 28
DraIII CACNNNGTG 1 cut(s) 148
EaeI YGGCCR 1 cut(s) 201
Eam1104I CTCTTC 1 cut(s) 316
EarI CTCTTC 1 cut(s) 316
Eco147I AGGCCT 1 cut(s) 190
Eco47I GGWCC 1 cut(s) 377
Eco57I CTGAAG 2 cut(s) 266, 351
EcoO109I RGGNCCY 1 cut(s) 138
EcoRII CCWGG 2 cut(s) 185, 219
FaeI CATG 2 cut(s) 318, 347
FaiI YATR 4 cut(s) 81, 316, 345, 363
FatI CATG 2 cut(s) 314, 343
FauI CCCGC 1 cut(s) 153
Fnu4HI GCNGC 2 cut(s) 294, 372
FokI GGATG 1 cut(s) 226
Fsp4HI GCNGC 2 cut(s) 294, 372
FspBI CTAG 1 cut(s) 176
GluI GCNGC 2 cut(s) 294, 372
GsuI CTGGAG 1 cut(s) 258
HaeIII GGCC 3 cut(s) 139, 190, 203
HapII CCGG 1 cut(s) 38
Hin1II CATG 2 cut(s) 318, 347
HindIII AAGCTT 1 cut(s) 303
HinfI GANTC 3 cut(s) 4, 272, 286
HpaII CCGG 1 cut(s) 38
HphI GGTGA 1 cut(s) 47
Hpy188I TCNGA 5 cut(s) 157, 172, 259, 277, 285
Hpy188III TCNNGA 2 cut(s) 20, 237
Hpy99I CGWCG 1 cut(s) 325
HpyAV CCTTC 2 cut(s) 124, 290
HpyCH4III ACNGT 1 cut(s) 263
HpyCH4IV ACGT 1 cut(s) 147
HpyCH4V TGCA 3 cut(s) 293, 337, 347
HpyF10VI GCNNNNNNNGC 3 cut(s) 110, 187, 302
HpySE526I ACGT 1 cut(s) 147
Hsp92II CATG 2 cut(s) 318, 347
LmnI GCTCC 2 cut(s) 157, 172
LpnPI CCDG 8 cut(s) 51, 172, 196, 199, 206, 222, 233, 360
Lsp1109I GCAGC 2 cut(s) 305, 358
LweI GCATC 3 cut(s) 20, 161, 176
MaeI CTAG 1 cut(s) 176
MaeII ACGT 1 cut(s) 147
MbiI CCGCTC 1 cut(s) 160
MboII GAAGA 1 cut(s) 303
MlsI TGGCCA 1 cut(s) 203
MluCI AATT 2 cut(s) 23, 74
MluNI TGGCCA 1 cut(s) 203
MlyI GAGTC 1 cut(s) 280
MmeI TCCRAC 1 cut(s) 300
MnlI CCTC 8 cut(s) 115, 129, 157, 201, 244, 265, 319, 390
Mox20I TGGCCA 1 cut(s) 203
MscI TGGCCA 1 cut(s) 203
MseI TTAA 1 cut(s) 27
Msp20I TGGCCA 1 cut(s) 203
MspA1I CMGCKG 1 cut(s) 371
MspI CCGG 1 cut(s) 38
MspR9I CCNGG 2 cut(s) 187, 221
Mva1269I GAATGC 1 cut(s) 181
MvaI CCWGG 2 cut(s) 187, 221
MwoI GCNNNNNNNGC 3 cut(s) 110, 187, 302
NlaIII CATG 2 cut(s) 318, 347
NlaIV GGNNCC 2 cut(s) 140, 232
NspI RCATGY 1 cut(s) 347
PceI AGGCCT 1 cut(s) 190
PctI GAATGC 1 cut(s) 181
PfeI GAWTC 2 cut(s) 4, 272
PflMI CCANNNNNTGG 2 cut(s) 148, 210
PkrI GCNGC 2 cut(s) 295, 373
PleI GAGTC 1 cut(s) 280
PpsI GAGTC 1 cut(s) 280
Ppu21I YACGTR 1 cut(s) 148
Psp6I CCWGG 2 cut(s) 185, 219
PspGI CCWGG 2 cut(s) 185, 219
PspN4I GGNNCC 2 cut(s) 140, 232
PspPI GGNCC 2 cut(s) 138, 377
PstNI CAGNNNCTG 1 cut(s) 374
PvuII CAGCTG 1 cut(s) 371
SaqAI TTAA 1 cut(s) 27
SatI GCNGC 2 cut(s) 294, 372
Sau96I GGNCC 2 cut(s) 138, 377
SchI GAGTC 1 cut(s) 280
ScrFI CCNGG 2 cut(s) 187, 221
SfaNI GCATC 3 cut(s) 20, 161, 176
SinI GGWCC 1 cut(s) 377
SmlI CTYRAG 1 cut(s) 133
SmoI CTYRAG 1 cut(s) 133
Sse9I AATT 2 cut(s) 23, 74
SseBI AGGCCT 1 cut(s) 190
SsiI CCGC 2 cut(s) 58, 160
SspMI CTAG 1 cut(s) 176
StuI AGGCCT 1 cut(s) 190
StyD4I CCNGG 2 cut(s) 185, 219
TaaI ACNGT 1 cut(s) 263
TaiI ACGT 1 cut(s) 150
TasI AATT 2 cut(s) 23, 74
TfiI GAWTC 2 cut(s) 4, 272
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TseI GCWGC 2 cut(s) 293, 371
TspDTI ATGAA 1 cut(s) 303
Van91I CCANNNNNTGG 2 cut(s) 148, 210
VpaK11BI GGWCC 1 cut(s) 377
XapI RAATTY 2 cut(s) 23, 74
XceI RCATGY 1 cut(s) 347
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.