pycom13g20700

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
16880113 .. 16880760
648 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g20700.1

Sequence Viewer

Length: 648 bp
ATGACTAACTCATCGAACCTTTGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCACCCCTTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTTCAGGTGAAGACTCCATGATGACGGATGCAACAACAGCTACGATAGTAGCTAGAAACCTCCTCACTCCTAAGGATAGTAGGCTGCTTTCAGGACGGTCTGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTCAGCGTTCAGTGTGCAGGCTCTGTGTCCAACATGGGCCAACGCCTATTTGCTCGCTCCCGTCAGGTTGAATCGTTGATGGCAGAGGTGGAAAGTCTTAAGCAAGAGATCAAGCAGCTGAAGTATGAGAATAGAAGTTTGCACGTGCTTGCAAACAACTATTCGACGGGCATGAAAAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCAAAGTGACCGTCAAACGTTTTCGTCTTTCCTCCAGAGGCACATTTTTCCTGGGTCTTCCAGCGTTTGGCCAAGTATTGAGGCTTCGAATGCTCTATCTTCGATGCCTCCCGCTCCGATGCCTTCTGCTCCGATGCCTTCCGCTTCTAGAGTTTTGCCAAGTAATGGGACTTCACGTGAACATCCTTTGTGA

Protein Analysis

216

Amino Acids

23.38

Weight (kDa)

6.31

Isoelectric Point (pI)

66.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 78
AccB7I CCANNNNNTGG 2 cut(s) 522, 620
AccBSI CCGCTC 1 cut(s) 569
AciI CCGC 2 cut(s) 567, 597
AclI AACGTT 1 cut(s) 473
AclWI GGATC 1 cut(s) 41
AcoI YGGCCR 2 cut(s) 219, 524
AcuI CTGAAG 2 cut(s) 380, 465
AcvI CACGTG 2 cut(s) 385, 632
AcyI GRCGYC 1 cut(s) 79
AfiI CCNNNNNNNGG 4 cut(s) 65, 113, 522, 620
AflII CTTAAG 1 cut(s) 338
AgsI TTSAA 4 cut(s) 65, 227, 311, 458
AjnI CCWGG 1 cut(s) 505
AluBI AGCT 5 cut(s) 149, 161, 358, 424, 433
AluI AGCT 5 cut(s) 149, 161, 358, 424, 433
Alw26I GTCTC 1 cut(s) 41
AlwI GGATC 1 cut(s) 41
AlwNI CAGNNNCTG 1 cut(s) 263
AoxI GGCC 3 cut(s) 219, 277, 524
ApeKI GCWGC 4 cut(s) 42, 193, 355, 433
ArsI GACNNNNNNTTYG 2 cut(s) 451, 483
AspLEI GCGC 1 cut(s) 81
AspS9I GGNCC 2 cut(s) 104, 277
AsuHPI GGTGA 1 cut(s) 128
AsuII TTCGAA 1 cut(s) 542
AvaII GGWCC 1 cut(s) 104
AxyI CCTNAGG 1 cut(s) 180
BalI TGGCCA 1 cut(s) 526
BanI GGYRCC 1 cut(s) 78
BarI GAAGNNNNNNTAC 4 cut(s) 523, 555, 610, 642
BbrPI CACGTG 2 cut(s) 385, 632
BbsI GAAGAC 2 cut(s) 126, 504
BbvI GCAGC 4 cut(s) 54, 180, 367, 420
BccI CCATC 1 cut(s) 313
BceAI ACGGC 1 cut(s) 206
BcgI CGANNNNNNTGC 2 cut(s) 35, 69
BciT130I CCWGG 1 cut(s) 507
BcoDI GTCTC 1 cut(s) 41
BfaI CTAG 2 cut(s) 162, 603
BfoI RGCGCY 1 cut(s) 82
BfrI CTTAAG 1 cut(s) 338
BisI GCNGC 4 cut(s) 43, 194, 356, 434
BlsI GCNGC 4 cut(s) 44, 195, 357, 435
Bme1390I CCNGG 1 cut(s) 507
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 2 cut(s) 104, 277
BmiI GGNNCC 1 cut(s) 80
BmrFI CCNGG 1 cut(s) 507
BmsI GCATC 4 cut(s) 127, 549, 564, 579
BpiI GAAGAC 2 cut(s) 126, 504
BpmI CTGGAG 1 cut(s) 473
Bpu14I TTCGAA 1 cut(s) 542
BsaAI YACGTR 2 cut(s) 385, 632
BsaHI GRCGYC 1 cut(s) 79
BsaJI CCNNGG 1 cut(s) 506
BsaWI WCCGGW 1 cut(s) 49
Bsc4I CCNNNNNNNGG 4 cut(s) 65, 113, 522, 620
Bse21I CCTNAGG 1 cut(s) 180
BseBI CCWGG 1 cut(s) 507
BseDI CCNNGG 1 cut(s) 506
BseGI GGATG 2 cut(s) 142, 637
BseLI CCNNNNNNNGG 4 cut(s) 65, 113, 522, 620
BseMII CTCAG 2 cut(s) 52, 256
BseRI GAGGAG 1 cut(s) 161
BseXI GCAGC 4 cut(s) 54, 180, 367, 420
BsgI GTGCAG 1 cut(s) 276
BshFI GGCC 3 cut(s) 221, 279, 526
BshNI GGYRCC 1 cut(s) 78
BsiSI CCGG 1 cut(s) 50
BslFI GGGAC 2 cut(s) 217, 637
BslI CCNNNNNNNGG 4 cut(s) 65, 113, 522, 620
BsmAI GTCTC 1 cut(s) 41
BsmFI GGGAC 2 cut(s) 217, 637
BsmI GAATGC 1 cut(s) 550
BsnI GGCC 3 cut(s) 221, 279, 526
Bsp119I TTCGAA 1 cut(s) 542
Bsp143I GATC 2 cut(s) 46, 348
BspACI CCGC 2 cut(s) 567, 597
BspANI GGCC 3 cut(s) 221, 279, 526
BspCNI CTCAG 2 cut(s) 51, 255
BspLI GGNNCC 1 cut(s) 80
BspPI GGATC 1 cut(s) 41
BspT104I TTCGAA 1 cut(s) 542
BspT107I GGYRCC 1 cut(s) 78
BspTI CTTAAG 1 cut(s) 338
BsrBI CCGCTC 1 cut(s) 569
BssECI CCNNGG 1 cut(s) 506
BssMI GATC 2 cut(s) 46, 348
BssNI GRCGYC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 507
Bst4CI ACNGT 3 cut(s) 104, 207, 467
BstACI GRCGYC 1 cut(s) 79
BstAFI CTTAAG 1 cut(s) 338
BstBAI YACGTR 2 cut(s) 385, 632
BstBI TTCGAA 1 cut(s) 542
BstC8I GCNNGC 3 cut(s) 259, 295, 390
BstDEI CTNAG 4 cut(s) 25, 38, 180, 242
BstENI CCTNNNNNAGG 1 cut(s) 111
BstF5I GGATG 2 cut(s) 142, 637
BstH2I RGCGCY 1 cut(s) 82
BstHHI GCGC 1 cut(s) 81
BstKTI GATC 2 cut(s) 49, 351
BstMAI GTCTC 1 cut(s) 41
BstMBI GATC 2 cut(s) 46, 348
BstMWI GCNNNNNNNGC 3 cut(s) 146, 430, 545
BstNI CCWGG 1 cut(s) 507
BstSCI CCNGG 1 cut(s) 505
BstV1I GCAGC 4 cut(s) 54, 180, 367, 420
BstV2I GAAGAC 2 cut(s) 126, 504
Bsu36I CCTNAGG 1 cut(s) 180
BsuRI GGCC 3 cut(s) 221, 279, 526
BtsCI GGATG 2 cut(s) 142, 637
BtsIMutI CAGTG 1 cut(s) 257
Cac8I GCNNGC 3 cut(s) 259, 295, 390
CaiI CAGNNNCTG 1 cut(s) 263
CfoI GCGC 1 cut(s) 81
Cfr13I GGNCC 2 cut(s) 104, 277
CviAII CATG 3 cut(s) 127, 274, 412
DdeI CTNAG 4 cut(s) 25, 38, 180, 242
DinI GGCGCC 1 cut(s) 80
DpnI GATC 2 cut(s) 48, 350
DpnII GATC 2 cut(s) 46, 348
EaeI YGGCCR 2 cut(s) 219, 524
Eco47I GGWCC 1 cut(s) 104
Eco57I CTGAAG 2 cut(s) 380, 465
Eco72I CACGTG 2 cut(s) 385, 632
Eco81I CCTNAGG 1 cut(s) 180
EcoNI CCTNNNNNAGG 1 cut(s) 111
EcoRII CCWGG 1 cut(s) 505
EgeI GGCGCC 1 cut(s) 80
EheI GGCGCC 1 cut(s) 80
FaeI CATG 3 cut(s) 130, 277, 415
FaiI YATR 5 cut(s) 76, 128, 275, 366, 413
FaqI GGGAC 2 cut(s) 217, 637
FatI CATG 3 cut(s) 126, 273, 411
FauI CCCGC 1 cut(s) 574
Fnu4HI GCNGC 4 cut(s) 43, 194, 356, 434
FokI GGATG 2 cut(s) 149, 624
Fsp4HI GCNGC 4 cut(s) 43, 194, 356, 434
FspBI CTAG 2 cut(s) 162, 603
GlaI GCGC 1 cut(s) 80
GluI GCNGC 4 cut(s) 43, 194, 356, 434
GsuI CTGGAG 1 cut(s) 473
HaeII RGCGCY 1 cut(s) 82
HaeIII GGCC 3 cut(s) 221, 279, 526
HapII CCGG 1 cut(s) 50
HhaI GCGC 1 cut(s) 81
Hin1I GRCGYC 1 cut(s) 79
Hin1II CATG 3 cut(s) 130, 277, 415
Hin6I GCGC 1 cut(s) 79
HinP1I GCGC 1 cut(s) 79
HindIII AAGCTT 1 cut(s) 422
HinfI GANTC 6 cut(s) 34, 122, 230, 311, 440, 454
HpaII CCGG 1 cut(s) 50
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 635
Hpy188I TCNGA 5 cut(s) 211, 445, 453, 573, 588
Hpy188III TCNNGA 4 cut(s) 201, 227, 490, 603
Hpy8I GTNNAC 1 cut(s) 635
Hpy99I CGWCG 1 cut(s) 409
HpyAV CCTTC 5 cut(s) 71, 93, 440, 588, 603
HpyCH4III ACNGT 3 cut(s) 104, 207, 467
HpyCH4IV ACGT 3 cut(s) 384, 473, 631
HpyCH4V TGCA 6 cut(s) 56, 140, 257, 382, 392, 436
HpyF10VI GCNNNNNNNGC 3 cut(s) 146, 430, 545
HpyF3I CTNAG 4 cut(s) 25, 38, 180, 242
HpySE526I ACGT 3 cut(s) 384, 473, 631
Hsp92I GRCGYC 1 cut(s) 79
Hsp92II CATG 3 cut(s) 130, 277, 415
HspAI GCGC 1 cut(s) 79
KasI GGCGCC 1 cut(s) 78
Kzo9I GATC 2 cut(s) 46, 348
LmnI GCTCC 3 cut(s) 302, 574, 589
LpnPI CCDG 9 cut(s) 63, 99, 186, 243, 290, 492, 503, 519, 529
Lsp1109I GCAGC 4 cut(s) 54, 180, 367, 420
LweI GCATC 4 cut(s) 127, 549, 564, 579
MaeI CTAG 2 cut(s) 162, 603
MaeII ACGT 3 cut(s) 384, 473, 631
MaeIII GTNAC 1 cut(s) 461
MalI GATC 2 cut(s) 48, 350
MbiI CCGCTC 1 cut(s) 569
MboI GATC 2 cut(s) 46, 348
MboII GAAGA 4 cut(s) 87, 131, 504, 546
MlsI TGGCCA 1 cut(s) 526
MluNI TGGCCA 1 cut(s) 526
Mly113I GGCGCC 1 cut(s) 79
MlyI GAGTC 4 cut(s) 43, 116, 239, 449
MmeI TCCRAC 2 cut(s) 294, 431
MnlI CCTC 9 cut(s) 117, 179, 182, 245, 319, 486, 497, 529, 573
Mox20I TGGCCA 1 cut(s) 526
MscI TGGCCA 1 cut(s) 526
MseI TTAA 1 cut(s) 339
Msp20I TGGCCA 1 cut(s) 526
MspA1I CMGCKG 1 cut(s) 358
MspCI CTTAAG 1 cut(s) 338
MspI CCGG 1 cut(s) 50
MspR9I CCNGG 1 cut(s) 507
Mva1269I GAATGC 1 cut(s) 550
MvaI CCWGG 1 cut(s) 507
MwoI GCNNNNNNNGC 3 cut(s) 146, 430, 545
NarI GGCGCC 1 cut(s) 79
NdeII GATC 2 cut(s) 46, 348
NlaIII CATG 3 cut(s) 130, 277, 415
NlaIV GGNNCC 1 cut(s) 80
NmuCI GTSAC 1 cut(s) 461
NspV TTCGAA 1 cut(s) 542
PcsI WCGNNNNNNNCGW 1 cut(s) 243
PctI GAATGC 1 cut(s) 550
PfeI GAWTC 2 cut(s) 311, 454
PflMI CCANNNNNTGG 2 cut(s) 522, 620
PkrI GCNGC 4 cut(s) 44, 195, 357, 435
PleI GAGTC 4 cut(s) 42, 116, 238, 448
PluTI GGCGCC 1 cut(s) 82
PmaCI CACGTG 2 cut(s) 385, 632
PmlI CACGTG 2 cut(s) 385, 632
PpsI GAGTC 4 cut(s) 42, 116, 238, 448
Ppu21I YACGTR 2 cut(s) 385, 632
Psp1406I AACGTT 1 cut(s) 473
Psp6I CCWGG 1 cut(s) 505
PspCI CACGTG 2 cut(s) 385, 632
PspGI CCWGG 1 cut(s) 505
PspN4I GGNNCC 1 cut(s) 80
PspPI GGNCC 2 cut(s) 104, 277
PstNI CAGNNNCTG 1 cut(s) 263
PvuII CAGCTG 1 cut(s) 358
SaqAI TTAA 1 cut(s) 339
SatI GCNGC 4 cut(s) 43, 194, 356, 434
Sau3AI GATC 2 cut(s) 46, 348
Sau96I GGNCC 2 cut(s) 104, 277
SchI GAGTC 4 cut(s) 43, 116, 239, 449
ScrFI CCNGG 1 cut(s) 507
SfaNI GCATC 4 cut(s) 127, 549, 564, 579
SfoI GGCGCC 1 cut(s) 80
SfuI TTCGAA 1 cut(s) 542
SinI GGWCC 1 cut(s) 104
SmlI CTYRAG 1 cut(s) 338
SmoI CTYRAG 1 cut(s) 338
SsiI CCGC 2 cut(s) 567, 597
SspDI GGCGCC 1 cut(s) 78
SspMI CTAG 2 cut(s) 162, 603
StyD4I CCNGG 1 cut(s) 505
TaaI ACNGT 3 cut(s) 104, 207, 467
TaiI ACGT 3 cut(s) 387, 476, 634
TaqI TCGA 4 cut(s) 14, 404, 542, 557
TfiI GAWTC 2 cut(s) 311, 454
Tru1I TTAA 1 cut(s) 339
Tru9I TTAA 1 cut(s) 339
TscAI CASTG 1 cut(s) 257
TseFI GTSAC 1 cut(s) 461
TseI GCWGC 4 cut(s) 42, 193, 355, 433
Tsp45I GTSAC 1 cut(s) 461
TspDTI ATGAA 1 cut(s) 428
TspGWI ACGGA 1 cut(s) 149
TspRI CASTG 1 cut(s) 257
Van91I CCANNNNNTGG 2 cut(s) 522, 620
Vha464I CTTAAG 1 cut(s) 338
VpaK11BI GGWCC 1 cut(s) 104
XagI CCTNNNNNAGG 1 cut(s) 111
XbaI TCTAGA 1 cut(s) 602
XspI CTAG 2 cut(s) 162, 603
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.