Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00012695

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

7541 .. 10257

Gene Structure 2717 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12695g00020.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 561 bp

ATGTACTCCAGGCATCTGGTATCATCTTTGGGGAAGAAGAAAGAATTGAGTATTTCGAAAGGCTTTGCTGGGAGTGCGCCCTCAGAGGTGAGGGAGAGTTGGGCATTTTCTTCAGGTTTGCCTTGCCATAAAAAACGAAGGTCGACATATATAGAGATAATATCAAGTGGTGGTATTGTTCTTTTACCCTTGTCGACAAACGTTTTGATCCCAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGCAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTCAAGCAGGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCACGTGCTTGCAAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGTTTTCGTCTTTCCTCAAGAGGAACGTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

187

Amino Acids

20.77

Weight (kDa)

9.9

Isoelectric Point (pI)

65.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	354
AccI	GTMKAC	2 cut(s)	143, 194
AciI	CCGC	1 cut(s)	352
AclI	AACGTT	2 cut(s)	201, 555
AclWI	GGATC	2 cut(s)	202, 400
AcoI	YGGCCR	1 cut(s)	276
AcuI	CTGAAG	2 cut(s)	96, 522
AcvI	CACGTG	1 cut(s)	442
AdeI	CACNNNGTG	1 cut(s)	302
AfaI	GTAC	2 cut(s)	5, 422
AfiI	CCNNNNNNNGG	1 cut(s)	364
AflII	CTTAAG	1 cut(s)	416
AgsI	TTSAA	2 cut(s)	284, 515
AjnI	CCWGG	1 cut(s)	8
AluBI	AGCT	4 cut(s)	218, 415, 481, 490
AluI	AGCT	4 cut(s)	218, 415, 481, 490
Alw26I	GTCTC	1 cut(s)	398
AlwI	GGATC	2 cut(s)	202, 400
AoxI	GGCC	2 cut(s)	276, 334
ApeKI	GCWGC	3 cut(s)	250, 412, 490
ArsI	GACNNNNNNTTYG	4 cut(s)	187, 219, 508, 540
AspLEI	GCGC	1 cut(s)	79
AspS9I	GGNCC	2 cut(s)	264, 334
AsuHPI	GGTGA	1 cut(s)	100
AsuII	TTCGAA	1 cut(s)	56
AvaII	GGWCC	1 cut(s)	264
BbrPI	CACGTG	1 cut(s)	442
BbvI	GCAGC	3 cut(s)	237, 424, 477
BccI	CCATC	1 cut(s)	370
BceAI	ACGGC	1 cut(s)	263
BciT130I	CCWGG	1 cut(s)	10
BcoDI	GTCTC	1 cut(s)	398
BfaI	CTAG	1 cut(s)	219
BfrI	CTTAAG	1 cut(s)	416
BisI	GCNGC	3 cut(s)	251, 413, 491
BlsI	GCNGC	3 cut(s)	252, 414, 492
Bme1390I	CCNGG	1 cut(s)	10
Bme18I	GGWCC	1 cut(s)	264
BmgT120I	GGNCC	2 cut(s)	264, 334
BmiI	GGNNCC	1 cut(s)	224
BmrFI	CCNGG	1 cut(s)	10
BmrI	ACTGGG	1 cut(s)	206
BmsI	GCATC	1 cut(s)	22
BmuI	ACTGGG	1 cut(s)	206
Bpu14I	TTCGAA	1 cut(s)	56
BpuEI	CTTGAG	2 cut(s)	380, 530
BsaAI	YACGTR	1 cut(s)	442
Bsc4I	CCNNNNNNNGG	1 cut(s)	364
Bse1I	ACTGG	1 cut(s)	212
BseBI	CCWGG	1 cut(s)	10
BseLI	CCNNNNNNNGG	1 cut(s)	364
BseMII	CTCAG	1 cut(s)	96
BseNI	ACTGG	1 cut(s)	212
BseRI	GAGGAG	1 cut(s)	218
BseXI	GCAGC	3 cut(s)	237, 424, 477
BseYI	CCCAGC	1 cut(s)	68
BshFI	GGCC	2 cut(s)	278, 336
BslFI	GGGAC	1 cut(s)	274
BslI	CCNNNNNNNGG	1 cut(s)	364
BsmAI	GTCTC	1 cut(s)	398
BsmFI	GGGAC	1 cut(s)	274
BsnI	GGCC	2 cut(s)	278, 336
Bsp119I	TTCGAA	1 cut(s)	56
Bsp143I	GATC	2 cut(s)	207, 405
BspACI	CCGC	1 cut(s)	352
BspANI	GGCC	2 cut(s)	278, 336
BspCNI	CTCAG	1 cut(s)	95
BspLI	GGNNCC	1 cut(s)	224
BspPI	GGATC	2 cut(s)	202, 400
BspT104I	TTCGAA	1 cut(s)	56
BspTI	CTTAAG	1 cut(s)	416
BsrBI	CCGCTC	1 cut(s)	354
BsrI	ACTGG	1 cut(s)	212
BssMI	GATC	2 cut(s)	207, 405
Bst2UI	CCWGG	1 cut(s)	10
Bst4CI	ACNGT	2 cut(s)	264, 524
Bst6I	CTCTTC	1 cut(s)	467
BstAFI	CTTAAG	1 cut(s)	416
BstBAI	YACGTR	1 cut(s)	442
BstBI	TTCGAA	1 cut(s)	56
BstC8I	GCNNGC	5 cut(s)	248, 344, 348, 352, 447
BstDEI	CTNAG	2 cut(s)	82, 299
BstHHI	GCGC	1 cut(s)	79
BstKTI	GATC	2 cut(s)	210, 408
BstMAI	GTCTC	1 cut(s)	398
BstMBI	GATC	2 cut(s)	207, 405
BstMWI	GCNNNNNNNGC	2 cut(s)	74, 487
BstNI	CCWGG	1 cut(s)	10
BstSCI	CCNGG	1 cut(s)	8
BstV1I	GCAGC	3 cut(s)	237, 424, 477
BstX2I	RGATCY	1 cut(s)	405
BstXI	CCANNNNNNTGG	1 cut(s)	16
BstYI	RGATCY	1 cut(s)	405
BsuRI	GGCC	2 cut(s)	278, 336
BtsIMutI	CAGTG	1 cut(s)	314
Cac8I	GCNNGC	5 cut(s)	248, 344, 348, 352, 447
CfoI	GCGC	1 cut(s)	79
Cfr13I	GGNCC	2 cut(s)	264, 334
CpoI	CGGWCCG	1 cut(s)	264
Csp6I	GTAC	2 cut(s)	4, 421
CspI	CGGWCCG	1 cut(s)	264
CviAII	CATG	2 cut(s)	331, 469
CviJI	RGCY	8 cut(s)	63, 218, 250, 278, 336, 415, 481, 490
CviKI_1	RGCY	8 cut(s)	63, 218, 250, 278, 336, 415, 481, 490
CviQI	GTAC	2 cut(s)	4, 421
DdeI	CTNAG	2 cut(s)	82, 299
DpnI	GATC	2 cut(s)	209, 407
DpnII	GATC	2 cut(s)	207, 405
DraIII	CACNNNGTG	1 cut(s)	302
EaeI	YGGCCR	1 cut(s)	276
Eam1104I	CTCTTC	1 cut(s)	467
EarI	CTCTTC	1 cut(s)	467
Eco47I	GGWCC	1 cut(s)	264
Eco57I	CTGAAG	2 cut(s)	96, 522
Eco72I	CACGTG	1 cut(s)	442
EcoRII	CCWGG	1 cut(s)	8
FaeI	CATG	2 cut(s)	334, 472
FaiI	YATR	6 cut(s)	129, 148, 150, 152, 332, 470
FaqI	GGGAC	1 cut(s)	274
FatI	CATG	2 cut(s)	330, 468
FauI	CCCGC	1 cut(s)	359
FblI	GTMKAC	2 cut(s)	143, 194
Fnu4HI	GCNGC	3 cut(s)	251, 413, 491
Fsp4HI	GCNGC	3 cut(s)	251, 413, 491
FspBI	CTAG	1 cut(s)	219
GlaI	GCGC	1 cut(s)	78
GluI	GCNGC	3 cut(s)	251, 413, 491
GsaI	CCCAGC	1 cut(s)	72
HaeIII	GGCC	2 cut(s)	278, 336
HhaI	GCGC	1 cut(s)	79
Hin1II	CATG	2 cut(s)	334, 472
Hin6I	GCGC	1 cut(s)	77
HinP1I	GCGC	1 cut(s)	77
HincII	GTYRAC	2 cut(s)	144, 195
HindII	GTYRAC	2 cut(s)	144, 195
HindIII	AAGCTT	1 cut(s)	479
HinfI	GANTC	4 cut(s)	287, 368, 497, 511
HphI	GGTGA	1 cut(s)	100
Hpy166II	GTNNAC	2 cut(s)	144, 195
Hpy188I	TCNGA	4 cut(s)	85, 268, 502, 510
Hpy188III	TCNNGA	3 cut(s)	258, 284, 547
Hpy8I	GTNNAC	2 cut(s)	144, 195
Hpy99I	CGWCG	1 cut(s)	466
HpyAV	CCTTC	2 cut(s)	132, 497
HpyCH4III	ACNGT	2 cut(s)	264, 524
HpyCH4IV	ACGT	3 cut(s)	201, 441, 555
HpyCH4V	TGCA	3 cut(s)	439, 449, 493
HpyF10VI	GCNNNNNNNGC	2 cut(s)	74, 487
HpyF3I	CTNAG	2 cut(s)	82, 299
HpySE526I	ACGT	3 cut(s)	201, 441, 555
Hsp92II	CATG	2 cut(s)	334, 472
HspAI	GCGC	1 cut(s)	77
Kzo9I	GATC	2 cut(s)	207, 405
LmnI	GCTCC	1 cut(s)	359
Lsp1109I	GCAGC	3 cut(s)	237, 424, 477
LweI	GCATC	1 cut(s)	22
MaeI	CTAG	1 cut(s)	219
MaeII	ACGT	3 cut(s)	201, 441, 555
MaeIII	GTNAC	1 cut(s)	518
MalI	GATC	2 cut(s)	209, 407
MbiI	CCGCTC	1 cut(s)	354
MboI	GATC	2 cut(s)	207, 405
MboII	GAAGA	4 cut(s)	46, 49, 102, 484
MflI	RGATCY	1 cut(s)	405
MluCI	AATT	1 cut(s)	44
MlyI	GAGTC	2 cut(s)	296, 506
MmeI	TCCRAC	2 cut(s)	351, 488
MseI	TTAA	1 cut(s)	417
MspCI	CTTAAG	1 cut(s)	416
MspR9I	CCNGG	1 cut(s)	10
MvaI	CCWGG	1 cut(s)	10
MwoI	GCNNNNNNNGC	2 cut(s)	74, 487
NdeII	GATC	2 cut(s)	207, 405
NlaIII	CATG	2 cut(s)	334, 472
NlaIV	GGNNCC	1 cut(s)	224
NmuCI	GTSAC	1 cut(s)	518
NspV	TTCGAA	1 cut(s)	56
PfeI	GAWTC	2 cut(s)	368, 511
PkrI	GCNGC	3 cut(s)	252, 414, 492
PleI	GAGTC	2 cut(s)	295, 505
PmaCI	CACGTG	1 cut(s)	442
PmlI	CACGTG	1 cut(s)	442
PpsI	GAGTC	2 cut(s)	295, 505
Ppu21I	YACGTR	1 cut(s)	442
Psp1406I	AACGTT	2 cut(s)	201, 555
Psp6I	CCWGG	1 cut(s)	8
PspCI	CACGTG	1 cut(s)	442
PspFI	CCCAGC	1 cut(s)	68
PspGI	CCWGG	1 cut(s)	8
PspN4I	GGNNCC	1 cut(s)	224
PspPI	GGNCC	2 cut(s)	264, 334
PsuI	RGATCY	1 cut(s)	405
RsaI	GTAC	2 cut(s)	5, 422
RsaNI	GTAC	2 cut(s)	4, 421
Rsr2I	CGGWCCG	1 cut(s)	264
RsrII	CGGWCCG	1 cut(s)	264
SalI	GTCGAC	2 cut(s)	142, 193
SaqAI	TTAA	1 cut(s)	417
SatI	GCNGC	3 cut(s)	251, 413, 491
Sau3AI	GATC	2 cut(s)	207, 405
Sau96I	GGNCC	2 cut(s)	264, 334
SchI	GAGTC	2 cut(s)	296, 506
ScrFI	CCNGG	1 cut(s)	10
SfaNI	GCATC	1 cut(s)	22
SfuI	TTCGAA	1 cut(s)	56
SinI	GGWCC	1 cut(s)	264
SmlI	CTYRAG	3 cut(s)	395, 416, 545
SmoI	CTYRAG	3 cut(s)	395, 416, 545
Sse9I	AATT	1 cut(s)	44
SsiI	CCGC	1 cut(s)	352
SspMI	CTAG	1 cut(s)	219
StyD4I	CCNGG	1 cut(s)	8
TaaI	ACNGT	2 cut(s)	264, 524
TaiI	ACGT	3 cut(s)	204, 444, 558
TaqI	TCGA	4 cut(s)	56, 143, 194, 461
TasI	AATT	1 cut(s)	44
TatI	WGTACW	1 cut(s)	3
TfiI	GAWTC	2 cut(s)	368, 511
Tru1I	TTAA	1 cut(s)	417
Tru9I	TTAA	1 cut(s)	417
TscAI	CASTG	1 cut(s)	314
TseFI	GTSAC	1 cut(s)	518
TseI	GCWGC	3 cut(s)	250, 412, 490
Tsp45I	GTSAC	1 cut(s)	518
TspDTI	ATGAA	1 cut(s)	485
TspRI	CASTG	1 cut(s)	314
Vha464I	CTTAAG	1 cut(s)	416
VpaK11BI	GGWCC	1 cut(s)	264
XmiI	GTMKAC	2 cut(s)	143, 194
XspI	CTAG	1 cut(s)	219

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.