pycom04g07600

Nudix hydrolase 3-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0000120
Physical Location & Seq
Forward (+)
8330128 .. 8332913
2786 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g07600.1

Sequence Viewer

Length: 828 bp
ATGACTAACTCATCGAACCTTTGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGTGCCTCGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTATAGGTGAAGACTCTGTGATGAAGGACGCAACAACAGCTACGATAGTAGCTAGGAACCTCCTCACTCCTGAAGATAGTCGGCTGCTTTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTCAGTGTTCAGTGTGCAGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGCTCCCGCCAAGTTGAATCCTTGATGGCGGAGGTGGAAAGTCTTAAGCAAGAGATCAAACTGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCCAATGGTCGAATGCAAAGTGACCGTCAAAGGCTTGCGGCTTTCTTCCAGAGGCATATTTTTCCTGGCTCATCTAGCGTTCCACCAAGTATTGAGGCCTCTTCTTTGATGCCTCCCTCCGCAGTAGACAACCACCAAAAGGAACAGAGCCGCCAGTACTCTGCTGGGCTTCATCGTCTCCCACCTCCGGTAGCAGCTAGAGAGAGAAAGAGAGAGAGAGTGCTTGTGAGATGCAGGTTCTGGTCGCGCTGGAAGCCTTTATTGCAGATCTTACACACGAAACGGTTCGTTGCGAGGAGAGTCGTCGGCGACAGCGCGATCACCTCCGCTTCGGGATCTGGCATTCCGGGAAGGTTTCGCTTTTTCTTTTGCGGCAGCTCCGGATGA

Protein Analysis

276

Amino Acids

30.55

Weight (kDa)

10.18

Isoelectric Point (pI)

60.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 666
AccB1I GGYRCC 1 cut(s) 78
AccI GTMKAC 1 cut(s) 567
AccII CGCG 2 cut(s) 688, 758
AccIII TCCGGA 1 cut(s) 821
AciI CCGC 7 cut(s) 301, 323, 479, 561, 592, 768, 813
AclWI GGATC 2 cut(s) 41, 784
AcoI YGGCCR 1 cut(s) 219
AcuI CTGAAG 1 cut(s) 201
AcyI GRCGYC 1 cut(s) 79
AfaI GTAC 2 cut(s) 365, 599
AfiI CCNNNNNNNGG 4 cut(s) 65, 113, 580, 628
AflII CTTAAG 2 cut(s) 338, 359
AgsI TTSAA 2 cut(s) 227, 311
AjnI CCWGG 1 cut(s) 505
AluBI AGCT 6 cut(s) 149, 161, 424, 433, 638, 819
AluI AGCT 6 cut(s) 149, 161, 424, 433, 638, 819
Alw26I GTCTC 2 cut(s) 41, 623
AlwI GGATC 2 cut(s) 41, 784
AlwNI CAGNNNCTG 2 cut(s) 263, 681
Aor13HI TCCGGA 1 cut(s) 821
AoxI GGCC 3 cut(s) 219, 277, 537
ApeKI GCWGC 5 cut(s) 42, 193, 433, 635, 816
ArsI GACNNNNNNTTYG 2 cut(s) 451, 483
Asp700I GAANNNNTTC 1 cut(s) 725
AspLEI GCGC 3 cut(s) 81, 690, 758
AspS9I GGNCC 3 cut(s) 104, 207, 277
AsuC2I CCSGG 1 cut(s) 789
AsuHPI GGTGA 2 cut(s) 128, 754
AvaII GGWCC 2 cut(s) 104, 207
BanI GGYRCC 1 cut(s) 78
BbsI GAAGAC 1 cut(s) 126
BbvI GCAGC 4 cut(s) 54, 180, 420, 647
BccI CCATC 1 cut(s) 313
BceAI ACGGC 1 cut(s) 206
BciT130I CCWGG 1 cut(s) 507
BcnI CCSGG 1 cut(s) 789
BcoDI GTCTC 2 cut(s) 41, 623
BfaI CTAG 3 cut(s) 162, 516, 639
BfoI RGCGCY 1 cut(s) 82
BfrI CTTAAG 2 cut(s) 338, 359
BfuAI ACCTGC 1 cut(s) 666
BglII AGATCT 1 cut(s) 708
BisI GCNGC 8 cut(s) 43, 194, 434, 480, 592, 636, 814, 817
BlsI GCNGC 8 cut(s) 44, 195, 435, 481, 593, 637, 815, 818
BmcAI AGTACT 1 cut(s) 599
Bme1390I CCNGG 2 cut(s) 507, 789
Bme18I GGWCC 2 cut(s) 104, 207
BmgT120I GGNCC 3 cut(s) 104, 207, 277
BmiI GGNNCC 2 cut(s) 80, 167
BmrFI CCNGG 2 cut(s) 507, 789
BmsI GCATC 2 cut(s) 540, 662
BpiI GAAGAC 1 cut(s) 126
BpuMI CCSGG 1 cut(s) 789
BsaHI GRCGYC 1 cut(s) 79
BsaWI WCCGGW 3 cut(s) 49, 628, 821
Bsc4I CCNNNNNNNGG 4 cut(s) 65, 113, 580, 628
Bse1I ACTGG 1 cut(s) 595
BseAI TCCGGA 1 cut(s) 821
BseBI CCWGG 1 cut(s) 507
BseLI CCNNNNNNNGG 4 cut(s) 65, 113, 580, 628
BseMII CTCAG 2 cut(s) 52, 256
BseNI ACTGG 1 cut(s) 595
BseRI GAGGAG 2 cut(s) 161, 751
BseXI GCAGC 4 cut(s) 54, 180, 420, 647
BseYI CCCAGC 1 cut(s) 605
BsgI GTGCAG 1 cut(s) 276
Bsh1236I CGCG 2 cut(s) 688, 758
BshFI GGCC 3 cut(s) 221, 279, 539
BshNI GGYRCC 1 cut(s) 78
BsiSI CCGG 4 cut(s) 50, 629, 788, 822
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 4 cut(s) 65, 113, 580, 628
BsmAI GTCTC 2 cut(s) 41, 623
BsmBI CGTCTC 1 cut(s) 623
BsmFI GGGAC 1 cut(s) 217
BsmI GAATGC 2 cut(s) 459, 783
BsnI GGCC 3 cut(s) 221, 279, 539
Bsp13I TCCGGA 1 cut(s) 821
Bsp143I GATC 5 cut(s) 46, 348, 708, 759, 776
BspACI CCGC 7 cut(s) 301, 323, 479, 561, 592, 768, 813
BspANI GGCC 3 cut(s) 221, 279, 539
BspCNI CTCAG 2 cut(s) 51, 255
BspEI TCCGGA 1 cut(s) 821
BspFNI CGCG 2 cut(s) 688, 758
BspLI GGNNCC 2 cut(s) 80, 167
BspMI ACCTGC 1 cut(s) 666
BspPI GGATC 2 cut(s) 41, 784
BspT107I GGYRCC 1 cut(s) 78
BspTI CTTAAG 2 cut(s) 338, 359
BsrI ACTGG 1 cut(s) 595
BssMI GATC 5 cut(s) 46, 348, 708, 759, 776
BssNI GRCGYC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 507
Bst4CI ACNGT 4 cut(s) 104, 207, 467, 726
Bst6I CTCTTC 2 cut(s) 410, 547
BstACI GRCGYC 1 cut(s) 79
BstAFI CTTAAG 2 cut(s) 338, 359
BstC8I GCNNGC 4 cut(s) 259, 295, 390, 477
BstDEI CTNAG 3 cut(s) 25, 38, 242
BstENI CCTNNNNNAGG 2 cut(s) 63, 111
BstFNI CGCG 2 cut(s) 688, 758
BstH2I RGCGCY 1 cut(s) 82
BstHHI GCGC 3 cut(s) 81, 690, 758
BstKTI GATC 5 cut(s) 49, 351, 711, 762, 779
BstMAI GTCTC 2 cut(s) 41, 623
BstMBI GATC 5 cut(s) 46, 348, 708, 759, 776
BstMWI GCNNNNNNNGC 5 cut(s) 146, 430, 516, 694, 703
BstNI CCWGG 1 cut(s) 507
BstNSI RCATGY 1 cut(s) 386
BstSCI CCNGG 2 cut(s) 505, 787
BstUI CGCG 2 cut(s) 688, 758
BstV1I GCAGC 4 cut(s) 54, 180, 420, 647
BstV2I GAAGAC 1 cut(s) 126
BstX2I RGATCY 2 cut(s) 708, 776
BstYI RGATCY 2 cut(s) 708, 776
BsuRI GGCC 3 cut(s) 221, 279, 539
BtsIMutI CAGTG 2 cut(s) 250, 257
BveI ACCTGC 1 cut(s) 666
Cac8I GCNNGC 4 cut(s) 259, 295, 390, 477
CaiI CAGNNNCTG 2 cut(s) 263, 681
CfoI GCGC 3 cut(s) 81, 690, 758
Cfr13I GGNCC 3 cut(s) 104, 207, 277
CpoI CGGWCCG 1 cut(s) 207
CseI GACGC 1 cut(s) 146
Csp6I GTAC 2 cut(s) 364, 598
CspI CGGWCCG 1 cut(s) 207
CviAII CATG 3 cut(s) 274, 383, 412
CviQI GTAC 2 cut(s) 364, 598
DdeI CTNAG 3 cut(s) 25, 38, 242
DinI GGCGCC 1 cut(s) 80
DpnI GATC 5 cut(s) 48, 350, 710, 761, 778
DpnII GATC 5 cut(s) 46, 348, 708, 759, 776
EaeI YGGCCR 1 cut(s) 219
Eam1104I CTCTTC 2 cut(s) 410, 547
EarI CTCTTC 2 cut(s) 410, 547
EciI GGCGGA 1 cut(s) 338
Eco147I AGGCCT 1 cut(s) 539
Eco47I GGWCC 2 cut(s) 104, 207
Eco57I CTGAAG 1 cut(s) 201
EcoNI CCTNNNNNAGG 2 cut(s) 63, 111
EcoRII CCWGG 1 cut(s) 505
EgeI GGCGCC 1 cut(s) 80
EheI GGCGCC 1 cut(s) 80
Esp3I CGTCTC 1 cut(s) 623
FaeI CATG 3 cut(s) 277, 386, 415
FaiI YATR 6 cut(s) 76, 113, 275, 384, 413, 498
FaqI GGGAC 1 cut(s) 217
FatI CATG 3 cut(s) 273, 382, 411
FauI CCCGC 1 cut(s) 308
FblI GTMKAC 1 cut(s) 567
Fnu4HI GCNGC 8 cut(s) 43, 194, 434, 480, 592, 636, 814, 817
Fsp4HI GCNGC 8 cut(s) 43, 194, 434, 480, 592, 636, 814, 817
FspBI CTAG 3 cut(s) 162, 516, 639
GlaI GCGC 3 cut(s) 80, 689, 757
GluI GCNGC 8 cut(s) 43, 194, 434, 480, 592, 636, 814, 817
GsaI CCCAGC 1 cut(s) 609
HaeII RGCGCY 1 cut(s) 82
HaeIII GGCC 3 cut(s) 221, 279, 539
HapII CCGG 4 cut(s) 50, 629, 788, 822
HgaI GACGC 1 cut(s) 146
HhaI GCGC 3 cut(s) 81, 690, 758
Hin1I GRCGYC 1 cut(s) 79
Hin1II CATG 3 cut(s) 277, 386, 415
Hin6I GCGC 3 cut(s) 79, 688, 756
HinP1I GCGC 3 cut(s) 79, 688, 756
HindIII AAGCTT 1 cut(s) 422
HinfI GANTC 6 cut(s) 34, 122, 230, 311, 440, 741
HpaII CCGG 4 cut(s) 50, 629, 788, 822
HphI GGTGA 2 cut(s) 128, 754
Hpy166II GTNNAC 1 cut(s) 568
Hpy188I TCNGA 1 cut(s) 211
Hpy188III TCNNGA 6 cut(s) 179, 201, 227, 490, 774, 822
Hpy8I GTNNAC 1 cut(s) 568
Hpy99I CGWCG 2 cut(s) 409, 749
HpyAV CCTTC 3 cut(s) 93, 127, 786
HpyCH4III ACNGT 4 cut(s) 104, 207, 467, 726
HpyCH4V TGCA 7 cut(s) 257, 382, 392, 436, 457, 675, 706
HpyF10VI GCNNNNNNNGC 5 cut(s) 146, 430, 516, 694, 703
HpyF3I CTNAG 3 cut(s) 25, 38, 242
Hsp92I GRCGYC 1 cut(s) 79
Hsp92II CATG 3 cut(s) 277, 386, 415
HspAI GCGC 3 cut(s) 79, 688, 756
KasI GGCGCC 1 cut(s) 78
Kpn2I TCCGGA 1 cut(s) 821
Kzo9I GATC 5 cut(s) 46, 348, 708, 759, 776
LmnI GCTCC 2 cut(s) 302, 824
Lsp1109I GCAGC 4 cut(s) 54, 180, 420, 647
LweI GCATC 2 cut(s) 540, 662
MaeI CTAG 3 cut(s) 162, 516, 639
MaeIII GTNAC 1 cut(s) 461
MalI GATC 5 cut(s) 48, 350, 710, 761, 778
MboI GATC 5 cut(s) 46, 348, 708, 759, 776
MboII GAAGA 6 cut(s) 87, 131, 194, 427, 478, 534
MflI RGATCY 2 cut(s) 708, 776
Mly113I GGCGCC 1 cut(s) 79
MlyI GAGTC 4 cut(s) 43, 116, 239, 750
MmeI TCCRAC 1 cut(s) 294
MroI TCCGGA 1 cut(s) 821
MroXI GAANNNNTTC 1 cut(s) 725
MseI TTAA 2 cut(s) 339, 360
MspCI CTTAAG 2 cut(s) 338, 359
MspI CCGG 4 cut(s) 50, 629, 788, 822
MspR9I CCNGG 2 cut(s) 507, 789
Mva1269I GAATGC 2 cut(s) 459, 783
MvaI CCWGG 1 cut(s) 507
MvnI CGCG 2 cut(s) 688, 758
MwoI GCNNNNNNNGC 5 cut(s) 146, 430, 516, 694, 703
NarI GGCGCC 1 cut(s) 79
NciI CCSGG 1 cut(s) 789
NdeII GATC 5 cut(s) 46, 348, 708, 759, 776
NlaIII CATG 3 cut(s) 277, 386, 415
NlaIV GGNNCC 2 cut(s) 80, 167
NmuCI GTSAC 1 cut(s) 461
NspI RCATGY 1 cut(s) 386
PceI AGGCCT 1 cut(s) 539
PctI GAATGC 2 cut(s) 459, 783
PdmI GAANNNNTTC 1 cut(s) 725
PfeI GAWTC 2 cut(s) 311, 440
PfoI TCCNGGA 1 cut(s) 787
PkrI GCNGC 8 cut(s) 44, 195, 435, 481, 593, 637, 815, 818
PleI GAGTC 4 cut(s) 42, 116, 238, 749
PluTI GGCGCC 1 cut(s) 82
PpsI GAGTC 4 cut(s) 42, 116, 238, 749
Psp6I CCWGG 1 cut(s) 505
PspFI CCCAGC 1 cut(s) 605
PspGI CCWGG 1 cut(s) 505
PspN4I GGNNCC 2 cut(s) 80, 167
PspPI GGNCC 3 cut(s) 104, 207, 277
PstNI CAGNNNCTG 2 cut(s) 263, 681
PsuI RGATCY 2 cut(s) 708, 776
RsaI GTAC 2 cut(s) 365, 599
RsaNI GTAC 2 cut(s) 364, 598
Rsr2I CGGWCCG 1 cut(s) 207
RsrII CGGWCCG 1 cut(s) 207
SaqAI TTAA 2 cut(s) 339, 360
SatI GCNGC 8 cut(s) 43, 194, 434, 480, 592, 636, 814, 817
Sau3AI GATC 5 cut(s) 46, 348, 708, 759, 776
Sau96I GGNCC 3 cut(s) 104, 207, 277
ScaI AGTACT 1 cut(s) 599
SchI GAGTC 4 cut(s) 43, 116, 239, 750
ScrFI CCNGG 2 cut(s) 507, 789
SfaNI GCATC 2 cut(s) 540, 662
SfoI GGCGCC 1 cut(s) 80
SinI GGWCC 2 cut(s) 104, 207
SmlI CTYRAG 2 cut(s) 338, 359
SmoI CTYRAG 2 cut(s) 338, 359
SseBI AGGCCT 1 cut(s) 539
SsiI CCGC 7 cut(s) 301, 323, 479, 561, 592, 768, 813
SspDI GGCGCC 1 cut(s) 78
SspMI CTAG 3 cut(s) 162, 516, 639
StuI AGGCCT 1 cut(s) 539
StyD4I CCNGG 2 cut(s) 505, 787
TaaI ACNGT 4 cut(s) 104, 207, 467, 726
TaqI TCGA 2 cut(s) 14, 451
TatI WGTACW 1 cut(s) 597
TauI GCSGC 3 cut(s) 482, 594, 816
TfiI GAWTC 2 cut(s) 311, 440
Tru1I TTAA 2 cut(s) 339, 360
Tru9I TTAA 2 cut(s) 339, 360
TscAI CASTG 2 cut(s) 250, 257
TseFI GTSAC 1 cut(s) 461
TseI GCWGC 5 cut(s) 42, 193, 433, 635, 816
Tsp45I GTSAC 1 cut(s) 461
TspDTI ATGAA 3 cut(s) 146, 428, 602
TspRI CASTG 2 cut(s) 250, 257
Vha464I CTTAAG 2 cut(s) 338, 359
VpaK11BI GGWCC 2 cut(s) 104, 207
XagI CCTNNNNNAGG 2 cut(s) 63, 111
XceI RCATGY 1 cut(s) 386
XcmI CCANNNNNNNNNTGG 1 cut(s) 602
XmiI GTMKAC 1 cut(s) 567
XmnI GAANNNNTTC 1 cut(s) 725
XspI CTAG 3 cut(s) 162, 516, 639
ZrmI AGTACT 1 cut(s) 599
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.