Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr9

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

14699127 .. 14699759

Gene Structure 633 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom09g14910.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 633 bp

ATGACTAACTCATCGAACCTTTGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGTGCCCCATCTAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTACAGGTGAAGACTCTGTGATGAAGGACGCAACAACAGCTACGATAGTAGCTAGGAACCTCCTCACTCCTGAAGATAGTCGGCTGCTTTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTCAGTGTTCAGTGCGCAGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGCTCCCGCCAAGTTGAATCCTTGATGGCGGAGGTGGAAAGTCTCAAGCAAGAGATCAAGCAGCTGAAGTATGAGAATAGAAGTTTGCACGTGCTTGCAAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACATTTTTCCTGGGTCTTCCAGCGTTTGGCCAAGTATTGAGGCCTCGAATGCTCTATCTTCGATGCCTCCCGCTCCGATGCCTTCCGCTCCGAGAGTTTTGCCAAATAATGGGGCTTCACGTGAACATCCTTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

211

Amino Acids

22.97

Weight (kDa)

6.43

Isoelectric Point (pI)

62.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	256
AccB1I	GGYRCC	1 cut(s)	78
AccB7I	CCANNNNNTGG	2 cut(s)	522, 605
AccBSI	CCGCTC	2 cut(s)	569, 584
AciI	CCGC	4 cut(s)	301, 323, 567, 582
AclWI	GGATC	1 cut(s)	41
AcoI	YGGCCR	2 cut(s)	219, 524
AcuI	CTGAAG	3 cut(s)	201, 380, 465
AcvI	CACGTG	2 cut(s)	385, 617
AcyI	GRCGYC	1 cut(s)	79
AfiI	CCNNNNNNNGG	4 cut(s)	65, 113, 522, 605
AgsI	TTSAA	3 cut(s)	227, 311, 458
AjnI	CCWGG	1 cut(s)	505
AluBI	AGCT	5 cut(s)	149, 161, 358, 424, 433
AluI	AGCT	5 cut(s)	149, 161, 358, 424, 433
Alw26I	GTCTC	2 cut(s)	41, 341
AlwI	GGATC	1 cut(s)	41
AlwNI	CAGNNNCTG	1 cut(s)	263
AoxI	GGCC	4 cut(s)	219, 277, 524, 537
ApeKI	GCWGC	4 cut(s)	42, 193, 355, 433
ArsI	GACNNNNNNTTYG	2 cut(s)	451, 483
AspLEI	GCGC	2 cut(s)	81, 257
AspS9I	GGNCC	3 cut(s)	104, 207, 277
AsuHPI	GGTGA	1 cut(s)	128
AvaII	GGWCC	2 cut(s)	104, 207
BaeGI	GKGCMC	1 cut(s)	60
BalI	TGGCCA	1 cut(s)	526
BanI	GGYRCC	1 cut(s)	78
BbrPI	CACGTG	2 cut(s)	385, 617
BbsI	GAAGAC	2 cut(s)	126, 504
BbvI	GCAGC	4 cut(s)	54, 180, 367, 420
BccI	CCATC	2 cut(s)	69, 313
BceAI	ACGGC	1 cut(s)	206
BcgI	CGANNNNNNTGC	2 cut(s)	577, 611
BciT130I	CCWGG	1 cut(s)	507
BcoDI	GTCTC	2 cut(s)	41, 341
BfaI	CTAG	2 cut(s)	65, 162
BfoI	RGCGCY	1 cut(s)	82
BisI	GCNGC	4 cut(s)	43, 194, 356, 434
BlsI	GCNGC	4 cut(s)	44, 195, 357, 435
Bme1390I	CCNGG	1 cut(s)	507
Bme18I	GGWCC	2 cut(s)	104, 207
BmgT120I	GGNCC	3 cut(s)	104, 207, 277
BmiI	GGNNCC	2 cut(s)	80, 167
BmrFI	CCNGG	1 cut(s)	507
BmsI	GCATC	2 cut(s)	549, 564
BpiI	GAAGAC	2 cut(s)	126, 504
BpmI	CTGGAG	1 cut(s)	473
BpuEI	CTTGAG	1 cut(s)	323
BsaAI	YACGTR	2 cut(s)	385, 617
BsaHI	GRCGYC	1 cut(s)	79
BsaJI	CCNNGG	1 cut(s)	506
BsaWI	WCCGGW	1 cut(s)	49
Bsc4I	CCNNNNNNNGG	4 cut(s)	65, 113, 522, 605
BseBI	CCWGG	1 cut(s)	507
BseDI	CCNNGG	1 cut(s)	506
BseGI	GGATG	1 cut(s)	622
BseLI	CCNNNNNNNGG	4 cut(s)	65, 113, 522, 605
BseMII	CTCAG	2 cut(s)	52, 256
BseRI	GAGGAG	1 cut(s)	161
BseSI	GKGCMC	1 cut(s)	60
BseXI	GCAGC	4 cut(s)	54, 180, 367, 420
BshFI	GGCC	4 cut(s)	221, 279, 526, 539
BshNI	GGYRCC	1 cut(s)	78
BsiSI	CCGG	1 cut(s)	50
BslFI	GGGAC	1 cut(s)	217
BslI	CCNNNNNNNGG	4 cut(s)	65, 113, 522, 605
BsmAI	GTCTC	2 cut(s)	41, 341
BsmFI	GGGAC	1 cut(s)	217
BsmI	GAATGC	1 cut(s)	550
BsnI	GGCC	4 cut(s)	221, 279, 526, 539
Bsp1286I	GDGCHC	1 cut(s)	60
Bsp143I	GATC	2 cut(s)	46, 348
BspACI	CCGC	4 cut(s)	301, 323, 567, 582
BspANI	GGCC	4 cut(s)	221, 279, 526, 539
BspCNI	CTCAG	2 cut(s)	51, 255
BspLI	GGNNCC	2 cut(s)	80, 167
BspPI	GGATC	1 cut(s)	41
BspT107I	GGYRCC	1 cut(s)	78
BsrBI	CCGCTC	2 cut(s)	569, 584
BssECI	CCNNGG	1 cut(s)	506
BssMI	GATC	2 cut(s)	46, 348
BssNI	GRCGYC	1 cut(s)	79
Bst2UI	CCWGG	1 cut(s)	507
Bst4CI	ACNGT	3 cut(s)	104, 207, 467
Bst6I	CTCTTC	1 cut(s)	410
BstACI	GRCGYC	1 cut(s)	79
BstBAI	YACGTR	2 cut(s)	385, 617
BstC8I	GCNNGC	3 cut(s)	259, 295, 390
BstDEI	CTNAG	3 cut(s)	25, 38, 242
BstENI	CCTNNNNNAGG	1 cut(s)	111
BstF5I	GGATG	1 cut(s)	622
BstH2I	RGCGCY	1 cut(s)	82
BstHHI	GCGC	2 cut(s)	81, 257
BstKTI	GATC	2 cut(s)	49, 351
BstMAI	GTCTC	2 cut(s)	41, 341
BstMBI	GATC	2 cut(s)	46, 348
BstMWI	GCNNNNNNNGC	3 cut(s)	146, 430, 545
BstNI	CCWGG	1 cut(s)	507
BstSCI	CCNGG	1 cut(s)	505
BstSLI	GKGCMC	1 cut(s)	60
BstV1I	GCAGC	4 cut(s)	54, 180, 367, 420
BstV2I	GAAGAC	2 cut(s)	126, 504
BsuRI	GGCC	4 cut(s)	221, 279, 526, 539
BtsCI	GGATG	1 cut(s)	622
BtsIMutI	CAGTG	2 cut(s)	250, 257
Cac8I	GCNNGC	3 cut(s)	259, 295, 390
CaiI	CAGNNNCTG	1 cut(s)	263
CfoI	GCGC	2 cut(s)	81, 257
Cfr13I	GGNCC	3 cut(s)	104, 207, 277
CpoI	CGGWCCG	1 cut(s)	207
CseI	GACGC	1 cut(s)	146
CspI	CGGWCCG	1 cut(s)	207
CviAII	CATG	2 cut(s)	274, 412
DdeI	CTNAG	3 cut(s)	25, 38, 242
DinI	GGCGCC	1 cut(s)	80
DpnI	GATC	2 cut(s)	48, 350
DpnII	GATC	2 cut(s)	46, 348
EaeI	YGGCCR	2 cut(s)	219, 524
Eam1104I	CTCTTC	1 cut(s)	410
EarI	CTCTTC	1 cut(s)	410
EciI	GGCGGA	1 cut(s)	338
Eco147I	AGGCCT	1 cut(s)	539
Eco47I	GGWCC	2 cut(s)	104, 207
Eco57I	CTGAAG	3 cut(s)	201, 380, 465
Eco72I	CACGTG	2 cut(s)	385, 617
EcoNI	CCTNNNNNAGG	1 cut(s)	111
EcoRII	CCWGG	1 cut(s)	505
EgeI	GGCGCC	1 cut(s)	80
EheI	GGCGCC	1 cut(s)	80
FaeI	CATG	2 cut(s)	277, 415
FaiI	YATR	4 cut(s)	76, 275, 366, 413
FaqI	GGGAC	1 cut(s)	217
FatI	CATG	2 cut(s)	273, 411
FauI	CCCGC	2 cut(s)	308, 574
Fnu4HI	GCNGC	4 cut(s)	43, 194, 356, 434
FokI	GGATG	1 cut(s)	609
Fsp4HI	GCNGC	4 cut(s)	43, 194, 356, 434
FspBI	CTAG	2 cut(s)	65, 162
FspI	TGCGCA	1 cut(s)	256
GlaI	GCGC	2 cut(s)	80, 256
GluI	GCNGC	4 cut(s)	43, 194, 356, 434
GsuI	CTGGAG	1 cut(s)	473
HaeII	RGCGCY	1 cut(s)	82
HaeIII	GGCC	4 cut(s)	221, 279, 526, 539
HapII	CCGG	1 cut(s)	50
HgaI	GACGC	1 cut(s)	146
HhaI	GCGC	2 cut(s)	81, 257
Hin1I	GRCGYC	1 cut(s)	79
Hin1II	CATG	2 cut(s)	277, 415
Hin6I	GCGC	2 cut(s)	79, 255
HinP1I	GCGC	2 cut(s)	79, 255
HindIII	AAGCTT	1 cut(s)	422
HinfI	GANTC	6 cut(s)	34, 122, 230, 311, 440, 454
HpaII	CCGG	1 cut(s)	50
HphI	GGTGA	1 cut(s)	128
Hpy166II	GTNNAC	1 cut(s)	620
Hpy188I	TCNGA	5 cut(s)	211, 445, 453, 573, 588
Hpy188III	TCNNGA	4 cut(s)	179, 201, 227, 490
Hpy8I	GTNNAC	1 cut(s)	620
Hpy99I	CGWCG	1 cut(s)	409
HpyAV	CCTTC	4 cut(s)	93, 127, 440, 588
HpyCH4III	ACNGT	3 cut(s)	104, 207, 467
HpyCH4IV	ACGT	2 cut(s)	384, 616
HpyCH4V	TGCA	3 cut(s)	382, 392, 436
HpyF10VI	GCNNNNNNNGC	3 cut(s)	146, 430, 545
HpyF3I	CTNAG	3 cut(s)	25, 38, 242
HpySE526I	ACGT	2 cut(s)	384, 616
Hsp92I	GRCGYC	1 cut(s)	79
Hsp92II	CATG	2 cut(s)	277, 415
HspAI	GCGC	2 cut(s)	79, 255
KasI	GGCGCC	1 cut(s)	78
Kzo9I	GATC	2 cut(s)	46, 348
LmnI	GCTCC	3 cut(s)	302, 574, 589
LpnPI	CCDG	9 cut(s)	63, 99, 186, 192, 243, 492, 503, 519, 529
Lsp1109I	GCAGC	4 cut(s)	54, 180, 367, 420
LweI	GCATC	2 cut(s)	549, 564
MaeI	CTAG	2 cut(s)	65, 162
MaeII	ACGT	2 cut(s)	384, 616
MaeIII	GTNAC	1 cut(s)	461
MalI	GATC	2 cut(s)	48, 350
MbiI	CCGCTC	2 cut(s)	569, 584
MboI	GATC	2 cut(s)	46, 348
MboII	GAAGA	6 cut(s)	87, 131, 194, 427, 504, 546
MhlI	GDGCHC	1 cut(s)	60
MlsI	TGGCCA	1 cut(s)	526
MluNI	TGGCCA	1 cut(s)	526
Mly113I	GGCGCC	1 cut(s)	79
MlyI	GAGTC	4 cut(s)	43, 116, 239, 449
MmeI	TCCRAC	2 cut(s)	294, 431
Mox20I	TGGCCA	1 cut(s)	526
MscI	TGGCCA	1 cut(s)	526
Msp20I	TGGCCA	1 cut(s)	526
MspA1I	CMGCKG	1 cut(s)	358
MspI	CCGG	1 cut(s)	50
MspR9I	CCNGG	1 cut(s)	507
Mva1269I	GAATGC	1 cut(s)	550
MvaI	CCWGG	1 cut(s)	507
MwoI	GCNNNNNNNGC	3 cut(s)	146, 430, 545
NarI	GGCGCC	1 cut(s)	79
NdeII	GATC	2 cut(s)	46, 348
NlaIII	CATG	2 cut(s)	277, 415
NlaIV	GGNNCC	2 cut(s)	80, 167
NmuCI	GTSAC	1 cut(s)	461
NsbI	TGCGCA	1 cut(s)	256
PceI	AGGCCT	1 cut(s)	539
PctI	GAATGC	1 cut(s)	550
PfeI	GAWTC	2 cut(s)	311, 454
PflMI	CCANNNNNTGG	2 cut(s)	522, 605
PkrI	GCNGC	4 cut(s)	44, 195, 357, 435
PleI	GAGTC	4 cut(s)	42, 116, 238, 448
PluTI	GGCGCC	1 cut(s)	82
PmaCI	CACGTG	2 cut(s)	385, 617
PmlI	CACGTG	2 cut(s)	385, 617
PpsI	GAGTC	4 cut(s)	42, 116, 238, 448
Ppu21I	YACGTR	2 cut(s)	385, 617
Psp6I	CCWGG	1 cut(s)	505
PspCI	CACGTG	2 cut(s)	385, 617
PspGI	CCWGG	1 cut(s)	505
PspN4I	GGNNCC	2 cut(s)	80, 167
PspPI	GGNCC	3 cut(s)	104, 207, 277
PstNI	CAGNNNCTG	1 cut(s)	263
PvuII	CAGCTG	1 cut(s)	358
Rsr2I	CGGWCCG	1 cut(s)	207
RsrII	CGGWCCG	1 cut(s)	207
SatI	GCNGC	4 cut(s)	43, 194, 356, 434
Sau3AI	GATC	2 cut(s)	46, 348
Sau96I	GGNCC	3 cut(s)	104, 207, 277
SchI	GAGTC	4 cut(s)	43, 116, 239, 449
ScrFI	CCNGG	1 cut(s)	507
SduI	GDGCHC	1 cut(s)	60
SfaNI	GCATC	2 cut(s)	549, 564
SfoI	GGCGCC	1 cut(s)	80
SinI	GGWCC	2 cut(s)	104, 207
SmlI	CTYRAG	1 cut(s)	338
SmoI	CTYRAG	1 cut(s)	338
SseBI	AGGCCT	1 cut(s)	539
SsiI	CCGC	4 cut(s)	301, 323, 567, 582
SspDI	GGCGCC	1 cut(s)	78
SspMI	CTAG	2 cut(s)	65, 162
StuI	AGGCCT	1 cut(s)	539
StyD4I	CCNGG	1 cut(s)	505
TaaI	ACNGT	3 cut(s)	104, 207, 467
TaiI	ACGT	2 cut(s)	387, 619
TaqI	TCGA	4 cut(s)	14, 404, 542, 557
TfiI	GAWTC	2 cut(s)	311, 454
TscAI	CASTG	2 cut(s)	250, 257
TseFI	GTSAC	1 cut(s)	461
TseI	GCWGC	4 cut(s)	42, 193, 355, 433
Tsp45I	GTSAC	1 cut(s)	461
TspDTI	ATGAA	2 cut(s)	146, 428
TspRI	CASTG	2 cut(s)	250, 257
Van91I	CCANNNNNTGG	2 cut(s)	522, 605
VpaK11BI	GGWCC	2 cut(s)	104, 207
XagI	CCTNNNNNAGG	1 cut(s)	111
XspI	CTAG	2 cut(s)	65, 162

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.