Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr1

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

925711 .. 929551

Gene Structure 3841 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom01g00960.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 702 bp

ATGCATGAACAAGGTTCCAACACTTTGGCTCCAATTAGGTCTTCAATTTCGTCCAACACTTTGGCTTCAAGCATAAGCTATCCGTCCTTAGCCCAAAAGTGCTCCAAAAGTCTCCAAAATGCATCTTTTTGCTCCTTTACATGCAACAACTTTAGAAAACAAAGAATCACAGAAAATAACTCTCCAAAGAAAGTAATGGCTCGAGTCTCACAGGGTTGTAGCGTTTGTTTGAGTTCCTTCCTTCAAGCATGTTACAAAAACGAATTTTTCTTTTATGATTGCATCAAACTTTCATCCATGTTTATAATTCTCTTTAACAGTCATGCAATTACAAACCAAATCCTCATCATTGTGTTGGAAGCAACGCTAGGTAAGCAATCAGGAATAGATTCCAGGCAGTTGGCTCCAGAACGGAAGACTGACTCCAAGTGCCGGCTGATTGCTTCTTTTACTTTGCCATCTACAATAGTAGCTAGGAACCTCCTCACACCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTTGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTCAAGCAGGAGATCAAACTGCTTAAGCATGAGAATAGAACTGCAAGAATCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

234

Amino Acids

25.84

Weight (kDa)

9.5

Isoelectric Point (pI)

53.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	305
AccBSI	CCGCTC	1 cut(s)	609
AciI	CCGC	1 cut(s)	607
AcoI	YGGCCR	1 cut(s)	531
AcsI	RAATTY	1 cut(s)	263
AdeI	CACNNNGTG	1 cut(s)	557
AfiI	CCNNNNNNNGG	2 cut(s)	432, 619
AflII	CTTAAG	1 cut(s)	671
AgsI	TTSAA	4 cut(s)	45, 69, 245, 539
AjnI	CCWGG	1 cut(s)	392
AjuI	GAANNNNNNNTTGG	2 cut(s)	25, 57
AluBI	AGCT	2 cut(s)	78, 473
AluI	AGCT	2 cut(s)	78, 473
Alw21I	GWGCWC	1 cut(s)	104
Alw26I	GTCTC	3 cut(s)	116, 211, 653
Ama87I	CYCGRG	1 cut(s)	201
AoxI	GGCC	2 cut(s)	531, 589
ApeKI	GCWGC	1 cut(s)	505
ApoI	RAATTY	1 cut(s)	263
Asp700I	GAANNNNTTC	1 cut(s)	388
AspS9I	GGNCC	2 cut(s)	519, 589
AvaI	CYCGRG	1 cut(s)	201
AvaII	GGWCC	1 cut(s)	519
BbsI	GAAGAC	2 cut(s)	33, 422
Bbv12I	GWGCWC	1 cut(s)	104
BbvI	GCAGC	1 cut(s)	492
BccI	CCATC	2 cut(s)	466, 625
BceAI	ACGGC	1 cut(s)	518
BciT130I	CCWGG	1 cut(s)	394
BcoDI	GTCTC	3 cut(s)	116, 211, 653
BfaI	CTAG	2 cut(s)	368, 474
BfrI	CTTAAG	1 cut(s)	671
BisI	GCNGC	1 cut(s)	506
BlsI	GCNGC	1 cut(s)	507
Bme1390I	CCNGG	1 cut(s)	394
Bme18I	GGWCC	1 cut(s)	519
BmeT110I	CYCGRG	1 cut(s)	201
BmgT120I	GGNCC	2 cut(s)	519, 589
BmiI	GGNNCC	4 cut(s)	16, 30, 405, 479
BmrFI	CCNGG	1 cut(s)	394
BmsI	GCATC	2 cut(s)	131, 291
BpiI	GAAGAC	2 cut(s)	33, 422
BpmI	CTGGAG	1 cut(s)	390
Bpu10I	CCTNAGC	1 cut(s)	88
BpuEI	CTTGAG	1 cut(s)	635
BsaXI	ACNNNNNCTCC	2 cut(s)	13, 43
Bsc4I	CCNNNNNNNGG	2 cut(s)	432, 619
Bse118I	RCCGGY	1 cut(s)	432
BseBI	CCWGG	1 cut(s)	394
BseGI	GGATG	1 cut(s)	293
BseLI	CCNNNNNNNGG	2 cut(s)	432, 619
BseRI	GAGGAG	1 cut(s)	473
BseXI	GCAGC	1 cut(s)	492
BshFI	GGCC	2 cut(s)	533, 591
BsiHKAI	GWGCWC	1 cut(s)	104
BsiHKCI	CYCGRG	1 cut(s)	201
BsiSI	CCGG	1 cut(s)	433
BslFI	GGGAC	1 cut(s)	529
BslI	CCNNNNNNNGG	2 cut(s)	432, 619
BsmAI	GTCTC	3 cut(s)	116, 211, 653
BsmFI	GGGAC	1 cut(s)	529
BsnI	GGCC	2 cut(s)	533, 591
BsoBI	CYCGRG	1 cut(s)	201
Bsp1286I	GDGCHC	1 cut(s)	104
Bsp143I	GATC	1 cut(s)	660
BspACI	CCGC	1 cut(s)	607
BspANI	GGCC	2 cut(s)	533, 591
BspLI	GGNNCC	4 cut(s)	16, 30, 405, 479
BspTI	CTTAAG	1 cut(s)	671
BsrBI	CCGCTC	1 cut(s)	609
BsrFI	RCCGGY	1 cut(s)	432
BssAI	RCCGGY	1 cut(s)	432
BssMI	GATC	1 cut(s)	660
Bst2UI	CCWGG	1 cut(s)	394
Bst4CI	ACNGT	2 cut(s)	320, 519
BstAFI	CTTAAG	1 cut(s)	671
BstC8I	GCNNGC	4 cut(s)	434, 599, 603, 607
BstDEI	CTNAG	2 cut(s)	88, 554
BstF5I	GGATG	1 cut(s)	293
BstKTI	GATC	1 cut(s)	663
BstMAI	GTCTC	3 cut(s)	116, 211, 653
BstMBI	GATC	1 cut(s)	660
BstMWI	GCNNNNNNNGC	1 cut(s)	373
BstNI	CCWGG	1 cut(s)	394
BstNSI	RCATGY	2 cut(s)	144, 252
BstSCI	CCNGG	1 cut(s)	392
BstV1I	GCAGC	1 cut(s)	492
BstV2I	GAAGAC	2 cut(s)	33, 422
BstXI	CCANNNNNNTGG	3 cut(s)	25, 61, 400
BsuRI	GGCC	2 cut(s)	533, 591
BtsCI	GGATG	1 cut(s)	293
BtsIMutI	CAGTG	1 cut(s)	569
Cac8I	GCNNGC	4 cut(s)	434, 599, 603, 607
Cfr10I	RCCGGY	1 cut(s)	432
Cfr13I	GGNCC	2 cut(s)	519, 589
CpoI	CGGWCCG	1 cut(s)	519
CspI	CGGWCCG	1 cut(s)	519
CviAII	CATG	7 cut(s)	5, 141, 249, 298, 323, 586, 677
DdeI	CTNAG	2 cut(s)	88, 554
DpnI	GATC	1 cut(s)	662
DpnII	GATC	1 cut(s)	660
DraIII	CACNNNGTG	1 cut(s)	557
EaeI	YGGCCR	1 cut(s)	531
Eco47I	GGWCC	1 cut(s)	519
Eco88I	CYCGRG	1 cut(s)	201
EcoRII	CCWGG	1 cut(s)	392
EcoT22I	ATGCAT	2 cut(s)	6, 124
FaeI	CATG	7 cut(s)	8, 144, 252, 301, 326, 589, 680
FalI	AAGNNNNNCTT	2 cut(s)	531, 563
FaqI	GGGAC	1 cut(s)	529
FatI	CATG	7 cut(s)	4, 140, 248, 297, 322, 585, 676
FauI	CCCGC	1 cut(s)	614
Fnu4HI	GCNGC	1 cut(s)	506
FokI	GGATG	1 cut(s)	280
Fsp4HI	GCNGC	1 cut(s)	506
FspBI	CTAG	2 cut(s)	368, 474
GluI	GCNGC	1 cut(s)	506
GsuI	CTGGAG	1 cut(s)	390
HaeIII	GGCC	2 cut(s)	533, 591
HapII	CCGG	1 cut(s)	433
Hin1II	CATG	7 cut(s)	8, 144, 252, 301, 326, 589, 680
HinfI	GANTC	7 cut(s)	165, 204, 389, 422, 542, 623, 696
HpaII	CCGG	1 cut(s)	433
Hpy188I	TCNGA	2 cut(s)	523, 701
Hpy188III	TCNNGA	4 cut(s)	381, 407, 513, 539
HpyAV	CCTTC	2 cut(s)	247, 251
HpyCH4III	ACNGT	2 cut(s)	320, 519
HpyCH4V	TGCA	7 cut(s)	4, 122, 144, 282, 326, 551, 692
HpyF10VI	GCNNNNNNNGC	1 cut(s)	373
HpyF3I	CTNAG	2 cut(s)	88, 554
Hsp92II	CATG	7 cut(s)	8, 144, 252, 301, 326, 589, 680
KroI	GCCGGC	1 cut(s)	432
KroNI	GCCGGC	1 cut(s)	434
Kzo9I	GATC	1 cut(s)	660
LmnI	GCTCC	5 cut(s)	34, 107, 137, 409, 614
Lsp1109I	GCAGC	1 cut(s)	492
LweI	GCATC	2 cut(s)	131, 291
MaeI	CTAG	2 cut(s)	368, 474
MaeIII	GTNAC	1 cut(s)	251
MalI	GATC	1 cut(s)	662
MbiI	CCGCTC	1 cut(s)	609
MboI	GATC	1 cut(s)	660
MboII	GAAGA	2 cut(s)	33, 427
MhlI	GDGCHC	1 cut(s)	104
MluCI	AATT	5 cut(s)	33, 45, 263, 306, 327
MlyI	GAGTC	3 cut(s)	213, 416, 551
MmeI	TCCRAC	4 cut(s)	42, 78, 336, 606
MnlI	CCTC	4 cut(s)	353, 491, 494, 631
Mph1103I	ATGCAT	2 cut(s)	6, 124
MroNI	GCCGGC	1 cut(s)	432
MroXI	GAANNNNTTC	1 cut(s)	388
MseI	TTAA	2 cut(s)	315, 672
MslI	CAYNNNNRTG	1 cut(s)	350
MspCI	CTTAAG	1 cut(s)	671
MspI	CCGG	1 cut(s)	433
MspR9I	CCNGG	1 cut(s)	394
MvaI	CCWGG	1 cut(s)	394
MwoI	GCNNNNNNNGC	1 cut(s)	373
NaeI	GCCGGC	1 cut(s)	434
NdeII	GATC	1 cut(s)	660
NgoMIV	GCCGGC	1 cut(s)	432
NlaIII	CATG	7 cut(s)	8, 144, 252, 301, 326, 589, 680
NlaIV	GGNNCC	4 cut(s)	16, 30, 405, 479
NsiI	ATGCAT	2 cut(s)	6, 124
NspI	RCATGY	2 cut(s)	144, 252
PaeR7I	CTCGAG	1 cut(s)	201
PdiI	GCCGGC	1 cut(s)	434
PdmI	GAANNNNTTC	1 cut(s)	388
PfeI	GAWTC	4 cut(s)	165, 389, 623, 696
PkrI	GCNGC	1 cut(s)	507
PleI	GAGTC	3 cut(s)	212, 416, 550
PpsI	GAGTC	3 cut(s)	212, 416, 550
PsiI	TTATAA	1 cut(s)	305
Psp6I	CCWGG	1 cut(s)	392
PspGI	CCWGG	1 cut(s)	392
PspN4I	GGNNCC	4 cut(s)	16, 30, 405, 479
PspPI	GGNCC	2 cut(s)	519, 589
PspXI	VCTCGAGB	1 cut(s)	201
RseI	CAYNNNNRTG	1 cut(s)	350
Rsr2I	CGGWCCG	1 cut(s)	519
RsrII	CGGWCCG	1 cut(s)	519
SaqAI	TTAA	2 cut(s)	315, 672
SatI	GCNGC	1 cut(s)	506
Sau3AI	GATC	1 cut(s)	660
Sau96I	GGNCC	2 cut(s)	519, 589
SchI	GAGTC	3 cut(s)	213, 416, 551
ScrFI	CCNGG	1 cut(s)	394
SduI	GDGCHC	1 cut(s)	104
SetI	ASST	8 cut(s)	16, 41, 80, 373, 475, 483, 621, 642
SfaNI	GCATC	2 cut(s)	131, 291
Sfr274I	CTCGAG	1 cut(s)	201
SinI	GGWCC	1 cut(s)	519
SlaI	CTCGAG	1 cut(s)	201
SmiMI	CAYNNNNRTG	1 cut(s)	350
SmlI	CTYRAG	3 cut(s)	201, 650, 671
SmoI	CTYRAG	3 cut(s)	201, 650, 671
Sse9I	AATT	5 cut(s)	33, 45, 263, 306, 327
SsiI	CCGC	1 cut(s)	607
SspMI	CTAG	2 cut(s)	368, 474
StyD4I	CCNGG	1 cut(s)	392
TaaI	ACNGT	2 cut(s)	320, 519
TaqI	TCGA	1 cut(s)	202
TasI	AATT	5 cut(s)	33, 45, 263, 306, 327
TfiI	GAWTC	4 cut(s)	165, 389, 623, 696
Tru1I	TTAA	2 cut(s)	315, 672
Tru9I	TTAA	2 cut(s)	315, 672
TscAI	CASTG	1 cut(s)	569
TseI	GCWGC	1 cut(s)	505
TspDTI	ATGAA	2 cut(s)	21, 282
TspGWI	ACGGA	2 cut(s)	72, 427
TspRI	CASTG	1 cut(s)	569
Vha464I	CTTAAG	1 cut(s)	671
VpaK11BI	GGWCC	1 cut(s)	519
XapI	RAATTY	1 cut(s)	263
XceI	RCATGY	2 cut(s)	144, 252
XhoI	CTCGAG	1 cut(s)	201
XmnI	GAANNNNTTC	1 cut(s)	388
XspI	CTAG	2 cut(s)	368, 474
Zsp2I	ATGCAT	2 cut(s)	6, 124

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.