pycom04g12720

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0000120
Physical Location & Seq
Reverse (-)
15700895 .. 15701687
793 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g12720.1

Sequence Viewer

Length: 750 bp
ATGGAAAGGTCCCAAAGAGTTGGTACATCTGATCATAACCAATCAAGGAACGACGTGTTTTCCAATACTTACAATTTGGACTGGAGTGATTATTCAAACTCTATGTGGTGGGAAAATCAAAATATTCAACAAGAAGGATATTGGCAGCCATATGAGGAGTTCTATTCAAGACCTATGCAGCCACCACAACCTCATATACAATATGCCCAACCAAACTCAGGTTCGTCAATAGATTATAATCAAATTCTTAATGAATTAATTTCTTTGGTGCAGGGCTCACAAAATCAAGCCAAGGAGGCTCAACAAGGAGAATATTGGCAACCATATGAGGAGTTTTATACAACACCTATGCAGCCACCACAATCTGCCCAAACAAATTCAGGTACATCTTTGTATAATGATATGCTTATTAAGTTACTCACCAATTTGTCTCAAGGGCAAGAGAATCAAAACAAAGTGATGCAAAATAAAGAAAAAGCAATGCAAAATCAAGACAAAAGGTTGGACCACTTGGAAAAGCAAATTGGGCAGATAGTGGAGTTCGTAGGACAATTTCGTGACCAAGGCAAATTCCCTAGTTCAACCATTGTAAATCCGAAGGGAGGATTTGAAACCACCAATGCTATCATGTTAAGAAGTGGCAAGAAGGTTGGAACGGACCCTCAACCATCAAAATCAAATCACAAGGAAGATGAAAGATTGCAATTTGAGGAAGAGGAGTTGGACAAAACCCCAATTCGTCCACCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

250

Amino Acids

28.94

Weight (kDa)

4.96

Isoelectric Point (pI)

49.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 237
AcsI RAATTY 3 cut(s) 243, 376, 569
AfaI GTAC 2 cut(s) 25, 385
AfiI CCNNNNNNNGG 2 cut(s) 218, 602
AflIII ACRYGT 1 cut(s) 54
AgsI TTSAA 5 cut(s) 96, 128, 168, 582, 611
AjiI CACGTC 1 cut(s) 55
AjuI GAANNNNNNNTTGG 4 cut(s) 205, 237, 507, 539
Alw26I GTCTC 1 cut(s) 435
ApeKI GCWGC 3 cut(s) 145, 178, 352
ApoI RAATTY 3 cut(s) 243, 376, 569
AseI ATTAAT 1 cut(s) 257
AspS9I GGNCC 3 cut(s) 9, 505, 658
AsuHPI GGTGA 1 cut(s) 412
AvaII GGWCC 3 cut(s) 9, 505, 658
BanII GRGCYC 1 cut(s) 278
BbvI GCAGC 3 cut(s) 157, 190, 364
BccI CCATC 1 cut(s) 676
BclI TGATCA 1 cut(s) 31
BcoDI GTCTC 1 cut(s) 435
BfaI CTAG 1 cut(s) 576
BglI GCCNNNNNGGC 1 cut(s) 296
BisI GCNGC 3 cut(s) 146, 179, 353
BlsI GCNGC 3 cut(s) 147, 180, 354
Bme18I GGWCC 3 cut(s) 9, 505, 658
BmgBI CACGTC 1 cut(s) 55
BmgT120I GGNCC 3 cut(s) 9, 505, 658
BmiI GGNNCC 2 cut(s) 11, 660
BmsI GCATC 1 cut(s) 450
BpmI CTGGAG 1 cut(s) 103
BpuEI CTTGAG 1 cut(s) 417
BsaBI GATNNNNATC 1 cut(s) 237
BsaJI CCNNGG 2 cut(s) 291, 562
Bsc4I CCNNNNNNNGG 2 cut(s) 218, 602
Bse1I ACTGG 1 cut(s) 86
Bse3DI GCAATG 1 cut(s) 486
Bse8I GATNNNNATC 1 cut(s) 237
BseDI CCNNGG 2 cut(s) 291, 562
BseJI GATNNNNATC 1 cut(s) 237
BseLI CCNNNNNNNGG 2 cut(s) 218, 602
BseMI GCAATG 1 cut(s) 486
BseMII CTCAG 1 cut(s) 231
BseNI ACTGG 1 cut(s) 86
BseRI GAGGAG 3 cut(s) 170, 344, 731
BseXI GCAGC 3 cut(s) 157, 190, 364
BsgI GTGCAG 1 cut(s) 290
BslI CCNNNNNNNGG 2 cut(s) 218, 602
BsmAI GTCTC 1 cut(s) 435
Bsp1286I GDGCHC 1 cut(s) 278
Bsp143I GATC 1 cut(s) 31
BspCNI CTCAG 1 cut(s) 230
BspLI GGNNCC 2 cut(s) 11, 660
BsrDI GCAATG 1 cut(s) 486
BsrI ACTGG 1 cut(s) 86
BssECI CCNNGG 2 cut(s) 291, 562
BssMI GATC 1 cut(s) 31
BssT1I CCWWGG 2 cut(s) 291, 562
Bst6I CTCTTC 1 cut(s) 708
BstDEI CTNAG 1 cut(s) 217
BstKTI GATC 1 cut(s) 34
BstMAI GTCTC 1 cut(s) 435
BstMBI GATC 1 cut(s) 31
BstMWI GCNNNNNNNGC 2 cut(s) 296, 526
BstV1I GCAGC 3 cut(s) 157, 190, 364
BstXI CCANNNNNNTGG 1 cut(s) 20
BtrI CACGTC 1 cut(s) 55
Cfr13I GGNCC 3 cut(s) 9, 505, 658
Csp6I GTAC 2 cut(s) 24, 384
CviAII CATG 1 cut(s) 628
CviJI RGCY 6 cut(s) 148, 181, 276, 290, 299, 355
CviKI_1 RGCY 6 cut(s) 148, 181, 276, 290, 299, 355
CviQI GTAC 2 cut(s) 24, 384
DdeI CTNAG 1 cut(s) 217
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
Eam1104I CTCTTC 1 cut(s) 708
EarI CTCTTC 1 cut(s) 708
Eco130I CCWWGG 2 cut(s) 291, 562
Eco24I GRGCYC 1 cut(s) 278
Eco47I GGWCC 3 cut(s) 9, 505, 658
EcoO109I RGGNCCY 1 cut(s) 9
EcoT14I CCWWGG 2 cut(s) 291, 562
EcoT38I GRGCYC 1 cut(s) 278
ErhI CCWWGG 2 cut(s) 291, 562
FaeI CATG 1 cut(s) 631
FatI CATG 1 cut(s) 627
FauNDI CATATG 2 cut(s) 151, 325
FbaI TGATCA 1 cut(s) 31
Fnu4HI GCNGC 3 cut(s) 146, 179, 353
FriOI GRGCYC 1 cut(s) 278
Fsp4HI GCNGC 3 cut(s) 146, 179, 353
FspBI CTAG 1 cut(s) 576
GluI GCNGC 3 cut(s) 146, 179, 353
GsuI CTGGAG 1 cut(s) 103
Hin1II CATG 1 cut(s) 631
HinfI GANTC 1 cut(s) 445
HphI GGTGA 1 cut(s) 412
Hpy166II GTNNAC 1 cut(s) 743
Hpy188I TCNGA 2 cut(s) 31, 597
Hpy188III TCNNGA 3 cut(s) 168, 491, 557
Hpy8I GTNNAC 1 cut(s) 743
Hpy99I CGWCG 1 cut(s) 56
HpyAV CCTTC 3 cut(s) 128, 592, 640
HpyCH4IV ACGT 1 cut(s) 54
HpyCH4V TGCA 6 cut(s) 178, 271, 352, 463, 484, 703
HpyF10VI GCNNNNNNNGC 2 cut(s) 296, 526
HpyF3I CTNAG 1 cut(s) 217
HpySE526I ACGT 1 cut(s) 54
Hsp92II CATG 1 cut(s) 631
Ksp22I TGATCA 1 cut(s) 31
Kzo9I GATC 1 cut(s) 31
LpnPI CCDG 4 cut(s) 67, 204, 257, 366
Lsp1109I GCAGC 3 cut(s) 157, 190, 364
LweI GCATC 1 cut(s) 450
MaeI CTAG 1 cut(s) 576
MaeII ACGT 1 cut(s) 54
MaeIII GTNAC 2 cut(s) 414, 557
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MboII GAAGA 2 cut(s) 701, 725
MhlI GDGCHC 1 cut(s) 278
MmeI TCCRAC 3 cut(s) 483, 631, 702
MnlI CCTC 8 cut(s) 148, 201, 289, 322, 596, 672, 703, 709
MseI TTAA 4 cut(s) 249, 257, 411, 632
MwoI GCNNNNNNNGC 2 cut(s) 296, 526
NdeI CATATG 2 cut(s) 151, 325
NdeII GATC 1 cut(s) 31
NlaIII CATG 1 cut(s) 631
NlaIV GGNNCC 2 cut(s) 11, 660
NmuCI GTSAC 1 cut(s) 557
PfeI GAWTC 1 cut(s) 445
PkrI GCNGC 3 cut(s) 147, 180, 354
PpuMI RGGWCCY 1 cut(s) 9
PshBI ATTAAT 1 cut(s) 257
PsiI TTATAA 1 cut(s) 237
Psp5II RGGWCCY 1 cut(s) 9
PspN4I GGNNCC 2 cut(s) 11, 660
PspPI GGNCC 3 cut(s) 9, 505, 658
PspPPI RGGWCCY 1 cut(s) 9
RsaI GTAC 2 cut(s) 25, 385
RsaNI GTAC 2 cut(s) 24, 384
SaqAI TTAA 4 cut(s) 249, 257, 411, 632
SatI GCNGC 3 cut(s) 146, 179, 353
Sau3AI GATC 1 cut(s) 31
Sau96I GGNCC 3 cut(s) 9, 505, 658
SduI GDGCHC 1 cut(s) 278
SetI ASST 9 cut(s) 11, 57, 175, 193, 223, 349, 385, 503, 651
SfaNI GCATC 1 cut(s) 450
SinI GGWCC 3 cut(s) 9, 505, 658
SmlI CTYRAG 1 cut(s) 432
SmoI CTYRAG 1 cut(s) 432
SspI AATATT 2 cut(s) 124, 314
SspMI CTAG 1 cut(s) 576
StyI CCWWGG 2 cut(s) 291, 562
TaiI ACGT 1 cut(s) 57
TfiI GAWTC 1 cut(s) 445
Tru1I TTAA 4 cut(s) 249, 257, 411, 632
Tru9I TTAA 4 cut(s) 249, 257, 411, 632
TseFI GTSAC 1 cut(s) 557
TseI GCWGC 3 cut(s) 145, 178, 352
Tsp45I GTSAC 1 cut(s) 557
TspDTI ATGAA 2 cut(s) 267, 708
TspGWI ACGGA 1 cut(s) 671
VpaK11BI GGWCC 3 cut(s) 9, 505, 658
VspI ATTAAT 1 cut(s) 257
XapI RAATTY 3 cut(s) 243, 376, 569
XspI CTAG 1 cut(s) 576
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.