Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr11

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

16574796 .. 16582152

Gene Structure 7357 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom11g15720.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 546 bp

ATGGAAATGGTAGAGGAGTGGGAATGGGGACACACGGGCCTACGCCTGCTTGCTCGGTCCCGCCAAGTGGAATCGTTGATGGCAGAGGTGGAAAGTCTTAAGCAGGAAATCAAACAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGGCGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAATGACCGTCAAAGGCTTGCGTCTTATCTCCAGAGGCACCTTTTTCCTGGGTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCAGCTCCGATGGCTTCCGCTCCTATGCCTCCCGCTTCTATGCCTCCCGCTTCTGCGCCTCGTAGTGGGGCTTCACGTAAACAACCTTTTGGTGTTTGGATTATAAGGGAAAGTGTTTGTGTTAGTTGTGGTGTGAGAAATGGAGAGATGGAATGGGGAGTGAATGAATTTCTCAATGAATGCATGGGTTTTTATAGGGGGAATGGGAGAATATGTTGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

182

Amino Acids

20.42

Weight (kDa)

7.67

Isoelectric Point (pI)

68.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	428
AccB1I	GGYRCC	1 cut(s)	255
AccB7I	CCANNNNNTGG	1 cut(s)	282
AccBSI	CCGCTC	1 cut(s)	344
AciI	CCGC	5 cut(s)	61, 167, 342, 357, 372
AcoI	YGGCCR	1 cut(s)	284
AcsI	RAATTY	2 cut(s)	213, 491
AfaI	GTAC	1 cut(s)	125
AfeI	AGCGCT	1 cut(s)	280
AfiI	CCNNNNNNNGG	3 cut(s)	67, 282, 389
AflII	CTTAAG	2 cut(s)	98, 119
AjnI	CCWGG	2 cut(s)	265, 299
AluBI	AGCT	5 cut(s)	118, 184, 193, 314, 329
AluI	AGCT	5 cut(s)	118, 184, 193, 314, 329
Aor51HI	AGCGCT	1 cut(s)	280
AoxI	GGCC	3 cut(s)	37, 284, 297
ApeKI	GCWGC	1 cut(s)	193
ApoI	RAATTY	2 cut(s)	213, 491
AspLEI	GCGC	2 cut(s)	281, 382
AspS9I	GGNCC	2 cut(s)	37, 57
AvaII	GGWCC	1 cut(s)	57
BalI	TGGCCA	1 cut(s)	286
BanI	GGYRCC	1 cut(s)	255
BarI	GAAGNNNNNNTAC	2 cut(s)	379, 411
BbvI	GCAGC	1 cut(s)	180
BccI	CCATC	3 cut(s)	73, 328, 466
BciT130I	CCWGG	2 cut(s)	267, 301
BfaI	CTAG	1 cut(s)	311
BfoI	RGCGCY	1 cut(s)	282
BfrI	CTTAAG	2 cut(s)	98, 119
BisI	GCNGC	1 cut(s)	194
BlsI	GCNGC	1 cut(s)	195
Bme1390I	CCNGG	2 cut(s)	267, 301
Bme18I	GGWCC	1 cut(s)	57
BmgT120I	GGNCC	2 cut(s)	37, 57
BmiI	GGNNCC	2 cut(s)	59, 257
BmrFI	CCNGG	2 cut(s)	267, 301
BmsI	GCATC	1 cut(s)	309
BpmI	CTGGAG	2 cut(s)	233, 309
BsaAI	YACGTR	1 cut(s)	401
BsaJI	CCNNGG	1 cut(s)	266
BsaXI	ACNNNNNCTCC	1 cut(s)	523
Bsc4I	CCNNNNNNNGG	3 cut(s)	67, 282, 389
BseBI	CCWGG	2 cut(s)	267, 301
BseDI	CCNNGG	1 cut(s)	266
BseGI	GGATG	1 cut(s)	272
BseLI	CCNNNNNNNGG	3 cut(s)	67, 282, 389
BseMII	CTCAG	1 cut(s)	195
BseRI	GAGGAG	1 cut(s)	29
BseXI	GCAGC	1 cut(s)	180
BshFI	GGCC	3 cut(s)	39, 286, 299
BshNI	GGYRCC	1 cut(s)	255
BslFI	GGGAC	2 cut(s)	42, 43
BslI	CCNNNNNNNGG	3 cut(s)	67, 282, 389
BsmFI	GGGAC	2 cut(s)	42, 43
BsmI	GAATGC	2 cut(s)	310, 509
BsnI	GGCC	3 cut(s)	39, 286, 299
BspACI	CCGC	5 cut(s)	61, 167, 342, 357, 372
BspANI	GGCC	3 cut(s)	39, 286, 299
BspCNI	CTCAG	1 cut(s)	196
BspLI	GGNNCC	2 cut(s)	59, 257
BspT107I	GGYRCC	1 cut(s)	255
BspTI	CTTAAG	2 cut(s)	98, 119
BsrBI	CCGCTC	1 cut(s)	344
BssECI	CCNNGG	1 cut(s)	266
Bst2UI	CCWGG	2 cut(s)	267, 301
Bst4CI	ACNGT	1 cut(s)	227
Bst6I	CTCTTC	1 cut(s)	170
BstAFI	CTTAAG	2 cut(s)	98, 119
BstBAI	YACGTR	1 cut(s)	401
BstC8I	GCNNGC	5 cut(s)	47, 51, 150, 169, 237
BstDEI	CTNAG	1 cut(s)	204
BstF5I	GGATG	1 cut(s)	272
BstH2I	RGCGCY	1 cut(s)	282
BstHHI	GCGC	2 cut(s)	281, 382
BstMWI	GCNNNNNNNGC	3 cut(s)	190, 305, 335
BstNI	CCWGG	2 cut(s)	267, 301
BstNSI	RCATGY	1 cut(s)	146
BstSCI	CCNGG	2 cut(s)	265, 299
BstV1I	GCAGC	1 cut(s)	180
BsuRI	GGCC	3 cut(s)	39, 286, 299
BtsCI	GGATG	1 cut(s)	272
Cac8I	GCNNGC	5 cut(s)	47, 51, 150, 169, 237
CfoI	GCGC	2 cut(s)	281, 382
Cfr13I	GGNCC	2 cut(s)	37, 57
CseI	GACGC	1 cut(s)	228
Csp6I	GTAC	1 cut(s)	124
CviAII	CATG	3 cut(s)	143, 172, 508
CviQI	GTAC	1 cut(s)	124
DdeI	CTNAG	1 cut(s)	204
EaeI	YGGCCR	1 cut(s)	284
Eam1104I	CTCTTC	1 cut(s)	170
EarI	CTCTTC	1 cut(s)	170
Eco147I	AGGCCT	1 cut(s)	299
Eco47I	GGWCC	1 cut(s)	57
Eco47III	AGCGCT	1 cut(s)	280
EcoRI	GAATTC	1 cut(s)	213
EcoRII	CCWGG	2 cut(s)	265, 299
EcoT22I	ATGCAT	1 cut(s)	509
FaeI	CATG	3 cut(s)	146, 175, 511
FaiI	YATR	8 cut(s)	144, 173, 350, 365, 428, 509, 519, 538
FaqI	GGGAC	2 cut(s)	42, 43
FatI	CATG	3 cut(s)	142, 171, 507
FauI	CCCGC	4 cut(s)	68, 160, 364, 379
Fnu4HI	GCNGC	1 cut(s)	194
FokI	GGATG	1 cut(s)	259
Fsp4HI	GCNGC	1 cut(s)	194
FspBI	CTAG	1 cut(s)	311
GlaI	GCGC	2 cut(s)	280, 381
GluI	GCNGC	1 cut(s)	194
GsuI	CTGGAG	2 cut(s)	233, 309
HaeII	RGCGCY	1 cut(s)	282
HaeIII	GGCC	3 cut(s)	39, 286, 299
HgaI	GACGC	1 cut(s)	228
HhaI	GCGC	2 cut(s)	281, 382
Hin1II	CATG	3 cut(s)	146, 175, 511
Hin6I	GCGC	2 cut(s)	279, 380
HinP1I	GCGC	2 cut(s)	279, 380
HindIII	AAGCTT	1 cut(s)	182
HinfI	GANTC	2 cut(s)	71, 200
Hpy166II	GTNNAC	1 cut(s)	404
Hpy188I	TCNGA	3 cut(s)	205, 318, 333
Hpy188III	TCNNGA	1 cut(s)	250
Hpy8I	GTNNAC	1 cut(s)	404
HpyCH4III	ACNGT	1 cut(s)	227
HpyCH4IV	ACGT	1 cut(s)	400
HpyCH4V	TGCA	4 cut(s)	142, 152, 196, 507
HpyF10VI	GCNNNNNNNGC	3 cut(s)	190, 305, 335
HpyF3I	CTNAG	1 cut(s)	204
HpySE526I	ACGT	1 cut(s)	400
Hsp92II	CATG	3 cut(s)	146, 175, 511
HspAI	GCGC	2 cut(s)	279, 380
LmnI	GCTCC	3 cut(s)	319, 334, 349
LpnPI	CCDG	9 cut(s)	59, 89, 252, 263, 279, 286, 289, 313, 339
Lsp1109I	GCAGC	1 cut(s)	180
LweI	GCATC	1 cut(s)	309
MaeI	CTAG	1 cut(s)	311
MaeII	ACGT	1 cut(s)	400
MbiI	CCGCTC	1 cut(s)	344
MboII	GAAGA	1 cut(s)	187
MlsI	TGGCCA	1 cut(s)	286
MluCI	AATT	2 cut(s)	213, 491
MluNI	TGGCCA	1 cut(s)	286
Mox20I	TGGCCA	1 cut(s)	286
Mph1103I	ATGCAT	1 cut(s)	509
MscI	TGGCCA	1 cut(s)	286
MseI	TTAA	2 cut(s)	99, 120
Msp20I	TGGCCA	1 cut(s)	286
MspCI	CTTAAG	2 cut(s)	98, 119
MspR9I	CCNGG	2 cut(s)	267, 301
Mva1269I	GAATGC	2 cut(s)	310, 509
MvaI	CCWGG	2 cut(s)	267, 301
MwoI	GCNNNNNNNGC	3 cut(s)	190, 305, 335
NlaIII	CATG	3 cut(s)	146, 175, 511
NlaIV	GGNNCC	2 cut(s)	59, 257
NsiI	ATGCAT	1 cut(s)	509
NspI	RCATGY	1 cut(s)	146
PceI	AGGCCT	1 cut(s)	299
PctI	GAATGC	2 cut(s)	310, 509
PfeI	GAWTC	2 cut(s)	71, 200
PflMI	CCANNNNNTGG	1 cut(s)	282
PkrI	GCNGC	1 cut(s)	195
Ppu21I	YACGTR	1 cut(s)	401
PsiI	TTATAA	1 cut(s)	428
Psp6I	CCWGG	2 cut(s)	265, 299
PspGI	CCWGG	2 cut(s)	265, 299
PspN4I	GGNNCC	2 cut(s)	59, 257
PspPI	GGNCC	2 cut(s)	37, 57
RsaI	GTAC	1 cut(s)	125
RsaNI	GTAC	1 cut(s)	124
SaqAI	TTAA	2 cut(s)	99, 120
SatI	GCNGC	1 cut(s)	194
Sau96I	GGNCC	2 cut(s)	37, 57
ScrFI	CCNGG	2 cut(s)	267, 301
SetI	ASST	9 cut(s)	90, 120, 186, 195, 261, 316, 331, 403, 412
SfaNI	GCATC	1 cut(s)	309
SinI	GGWCC	1 cut(s)	57
SmlI	CTYRAG	2 cut(s)	98, 119
SmoI	CTYRAG	2 cut(s)	98, 119
Sse9I	AATT	2 cut(s)	213, 491
SseBI	AGGCCT	1 cut(s)	299
SsiI	CCGC	5 cut(s)	61, 167, 342, 357, 372
SspMI	CTAG	1 cut(s)	311
StuI	AGGCCT	1 cut(s)	299
StyD4I	CCNGG	2 cut(s)	265, 299
TaaI	ACNGT	1 cut(s)	227
TaiI	ACGT	1 cut(s)	403
TaqI	TCGA	1 cut(s)	211
TaqII	GACCGA	1 cut(s)	45
TasI	AATT	2 cut(s)	213, 491
TfiI	GAWTC	2 cut(s)	71, 200
Tru1I	TTAA	2 cut(s)	99, 120
Tru9I	TTAA	2 cut(s)	99, 120
TseI	GCWGC	1 cut(s)	193
TspDTI	ATGAA	3 cut(s)	188, 504, 516
Van91I	CCANNNNNTGG	1 cut(s)	282
Vha464I	CTTAAG	2 cut(s)	98, 119
VpaK11BI	GGWCC	1 cut(s)	57
XapI	RAATTY	2 cut(s)	213, 491
XceI	RCATGY	1 cut(s)	146
XspI	CTAG	1 cut(s)	311
Zsp2I	ATGCAT	1 cut(s)	509

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.