pycom2599g00010

Zinc finger MYM-type protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00002599
OG0000120
Physical Location & Seq
Reverse (-)
7654 .. 8171
518 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom2599g00010.2

Sequence Viewer

Length: 372 bp
ATGATTCAGGCATCCAATCTTGAATTTAAACCATTACCGGATCATTTCAAGTATCACCGCCCATTCAAAGATAAATTCAATAAAGCAGATGTAGCCTTCACAGAGGTTGTTTGCTTGAAGCCCCACTACGTGGCATCGGAGCGGGAGGCATCGGAGCTAGAGCATTCCAGGCCTCAATACTTGGCCAAACGCTGGATGACCCAGGAAAAAGGTGCCTCTGGAGATAAGCTGAAAACCTCTGACGGTCGCTTTGAATCCGACCTTCAGACTCTTGCAGTTCATCAAGCTTCCTCTTCATGCCCGTCGAATAGTTGTTTGCAAGCACGTGCAAACTTCTATTCTCATACTTCAGCTGCTGGATCTCCTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

124

Amino Acids

13.79

Weight (kDa)

8.45

Isoelectric Point (pI)

54.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 212
AccB7I CCANNNNNTGG 2 cut(s) 130, 192
AccBSI CCGCTC 1 cut(s) 142
AciI CCGC 2 cut(s) 58, 142
AclWI GGATC 2 cut(s) 48, 367
AcoI YGGCCR 1 cut(s) 183
AcsI RAATTY 2 cut(s) 23, 74
AcuI CTGAAG 2 cut(s) 248, 333
AcvI CACGTG 1 cut(s) 326
AdeI CACNNNGTG 1 cut(s) 130
AfiI CCNNNNNNNGG 2 cut(s) 130, 192
AgsI TTSAA 6 cut(s) 23, 49, 67, 79, 118, 254
AjnI CCWGG 2 cut(s) 167, 201
AluBI AGCT 4 cut(s) 157, 229, 287, 353
AluI AGCT 4 cut(s) 157, 229, 287, 353
AlwI GGATC 2 cut(s) 48, 367
AlwNI CAGNNNCTG 1 cut(s) 356
AoxI GGCC 2 cut(s) 170, 183
ApeKI GCWGC 1 cut(s) 353
ApoI RAATTY 2 cut(s) 23, 74
ArsI GACNNNNNNTTYG 2 cut(s) 233, 265
AsuHPI GGTGA 1 cut(s) 47
BalI TGGCCA 1 cut(s) 185
BanI GGYRCC 1 cut(s) 212
BarI GAAGNNNNNNTAC 2 cut(s) 110, 142
BbrPI CACGTG 1 cut(s) 326
BbvI GCAGC 1 cut(s) 340
BciT130I CCWGG 2 cut(s) 169, 203
BfaI CTAG 1 cut(s) 158
BisI GCNGC 1 cut(s) 354
BlsI GCNGC 1 cut(s) 355
Bme1390I CCNGG 2 cut(s) 169, 203
BmiI GGNNCC 1 cut(s) 214
BmrFI CCNGG 2 cut(s) 169, 203
BmsI GCATC 3 cut(s) 20, 143, 158
BpmI CTGGAG 1 cut(s) 240
BsaAI YACGTR 2 cut(s) 130, 326
BsaJI CCNNGG 1 cut(s) 201
BsaWI WCCGGW 1 cut(s) 37
Bsc4I CCNNNNNNNGG 2 cut(s) 130, 192
BseBI CCWGG 2 cut(s) 169, 203
BseDI CCNNGG 1 cut(s) 201
BseGI GGATG 2 cut(s) 11, 201
BseLI CCNNNNNNNGG 2 cut(s) 130, 192
BseXI GCAGC 1 cut(s) 340
Bsh1285I CGRYCG 1 cut(s) 247
BshFI GGCC 2 cut(s) 172, 185
BshNI GGYRCC 1 cut(s) 212
BsiEI CGRYCG 1 cut(s) 247
BsiSI CCGG 1 cut(s) 38
BslI CCNNNNNNNGG 2 cut(s) 130, 192
BsmI GAATGC 1 cut(s) 163
BsnI GGCC 2 cut(s) 172, 185
Bsp143I GATC 2 cut(s) 40, 359
BspACI CCGC 2 cut(s) 58, 142
BspANI GGCC 2 cut(s) 172, 185
BspLI GGNNCC 1 cut(s) 214
BspPI GGATC 2 cut(s) 48, 367
BspT107I GGYRCC 1 cut(s) 212
BsrBI CCGCTC 1 cut(s) 142
BssECI CCNNGG 1 cut(s) 201
BssMI GATC 2 cut(s) 40, 359
Bst2UI CCWGG 2 cut(s) 169, 203
Bst4CI ACNGT 1 cut(s) 245
Bst6I CTCTTC 1 cut(s) 298
BstBAI YACGTR 2 cut(s) 130, 326
BstC8I GCNNGC 1 cut(s) 321
BstF5I GGATG 2 cut(s) 11, 201
BstKTI GATC 2 cut(s) 43, 362
BstMBI GATC 2 cut(s) 40, 359
BstMCI CGRYCG 1 cut(s) 247
BstMWI GCNNNNNNNGC 2 cut(s) 92, 169
BstNI CCWGG 2 cut(s) 169, 203
BstSCI CCNGG 2 cut(s) 167, 201
BstV1I GCAGC 1 cut(s) 340
BstX2I RGATCY 1 cut(s) 359
BstYI RGATCY 1 cut(s) 359
BsuRI GGCC 2 cut(s) 172, 185
BtsCI GGATG 2 cut(s) 11, 201
Cac8I GCNNGC 1 cut(s) 321
CaiI CAGNNNCTG 1 cut(s) 356
CviAII CATG 1 cut(s) 297
CviJI RGCY 8 cut(s) 95, 121, 157, 172, 185, 229, 287, 353
CviKI_1 RGCY 8 cut(s) 95, 121, 157, 172, 185, 229, 287, 353
DpnI GATC 2 cut(s) 42, 361
DpnII GATC 2 cut(s) 40, 359
DraI TTTAAA 1 cut(s) 28
DraIII CACNNNGTG 1 cut(s) 130
EaeI YGGCCR 1 cut(s) 183
Eam1104I CTCTTC 1 cut(s) 298
EarI CTCTTC 1 cut(s) 298
Eco147I AGGCCT 1 cut(s) 172
Eco57I CTGAAG 2 cut(s) 248, 333
Eco72I CACGTG 1 cut(s) 326
EcoRII CCWGG 2 cut(s) 167, 201
FaeI CATG 1 cut(s) 300
FaiI YATR 2 cut(s) 298, 345
FatI CATG 1 cut(s) 296
FauI CCCGC 1 cut(s) 135
Fnu4HI GCNGC 1 cut(s) 354
FokI GGATG 1 cut(s) 208
Fsp4HI GCNGC 1 cut(s) 354
FspBI CTAG 1 cut(s) 158
GluI GCNGC 1 cut(s) 354
GsuI CTGGAG 1 cut(s) 240
HaeIII GGCC 2 cut(s) 172, 185
HapII CCGG 1 cut(s) 38
Hin1II CATG 1 cut(s) 300
HindIII AAGCTT 1 cut(s) 285
HinfI GANTC 3 cut(s) 4, 254, 268
HpaII CCGG 1 cut(s) 38
HphI GGTGA 1 cut(s) 47
Hpy188I TCNGA 5 cut(s) 139, 154, 241, 259, 267
Hpy188III TCNNGA 2 cut(s) 20, 219
Hpy99I CGWCG 1 cut(s) 307
HpyAV CCTTC 2 cut(s) 106, 272
HpyCH4III ACNGT 1 cut(s) 245
HpyCH4IV ACGT 2 cut(s) 129, 325
HpyCH4V TGCA 3 cut(s) 275, 319, 329
HpyF10VI GCNNNNNNNGC 2 cut(s) 92, 169
HpySE526I ACGT 2 cut(s) 129, 325
Hsp92II CATG 1 cut(s) 300
Kzo9I GATC 2 cut(s) 40, 359
LmnI GCTCC 2 cut(s) 139, 154
LpnPI CCDG 8 cut(s) 51, 154, 178, 181, 188, 204, 215, 342
Lsp1109I GCAGC 1 cut(s) 340
LweI GCATC 3 cut(s) 20, 143, 158
MaeI CTAG 1 cut(s) 158
MaeII ACGT 2 cut(s) 129, 325
MalI GATC 2 cut(s) 42, 361
MbiI CCGCTC 1 cut(s) 142
MboI GATC 2 cut(s) 40, 359
MboII GAAGA 1 cut(s) 285
MflI RGATCY 1 cut(s) 359
MlsI TGGCCA 1 cut(s) 185
MluCI AATT 2 cut(s) 23, 74
MluNI TGGCCA 1 cut(s) 185
MlyI GAGTC 1 cut(s) 262
MmeI TCCRAC 1 cut(s) 282
MnlI CCTC 6 cut(s) 97, 139, 183, 226, 247, 301
Mox20I TGGCCA 1 cut(s) 185
MscI TGGCCA 1 cut(s) 185
MseI TTAA 1 cut(s) 27
Msp20I TGGCCA 1 cut(s) 185
MspA1I CMGCKG 1 cut(s) 353
MspI CCGG 1 cut(s) 38
MspR9I CCNGG 2 cut(s) 169, 203
Mva1269I GAATGC 1 cut(s) 163
MvaI CCWGG 2 cut(s) 169, 203
MwoI GCNNNNNNNGC 2 cut(s) 92, 169
NdeII GATC 2 cut(s) 40, 359
NlaIII CATG 1 cut(s) 300
NlaIV GGNNCC 1 cut(s) 214
PceI AGGCCT 1 cut(s) 172
PctI GAATGC 1 cut(s) 163
PfeI GAWTC 2 cut(s) 4, 254
PflMI CCANNNNNTGG 2 cut(s) 130, 192
PkrI GCNGC 1 cut(s) 355
PleI GAGTC 1 cut(s) 262
PmaCI CACGTG 1 cut(s) 326
PmlI CACGTG 1 cut(s) 326
PpsI GAGTC 1 cut(s) 262
Ppu21I YACGTR 2 cut(s) 130, 326
Psp6I CCWGG 2 cut(s) 167, 201
PspCI CACGTG 1 cut(s) 326
PspGI CCWGG 2 cut(s) 167, 201
PspN4I GGNNCC 1 cut(s) 214
PstNI CAGNNNCTG 1 cut(s) 356
PsuI RGATCY 1 cut(s) 359
PvuII CAGCTG 1 cut(s) 353
SaqAI TTAA 1 cut(s) 27
SatI GCNGC 1 cut(s) 354
Sau3AI GATC 2 cut(s) 40, 359
SchI GAGTC 1 cut(s) 262
ScrFI CCNGG 2 cut(s) 169, 203
SfaNI GCATC 3 cut(s) 20, 143, 158
Sse9I AATT 2 cut(s) 23, 74
SseBI AGGCCT 1 cut(s) 172
SsiI CCGC 2 cut(s) 58, 142
SspMI CTAG 1 cut(s) 158
StuI AGGCCT 1 cut(s) 172
StyD4I CCNGG 2 cut(s) 167, 201
TaaI ACNGT 1 cut(s) 245
TaiI ACGT 2 cut(s) 132, 328
TaqI TCGA 1 cut(s) 305
TasI AATT 2 cut(s) 23, 74
TfiI GAWTC 2 cut(s) 4, 254
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TseI GCWGC 1 cut(s) 353
TspDTI ATGAA 2 cut(s) 269, 285
Van91I CCANNNNNTGG 2 cut(s) 130, 192
XapI RAATTY 2 cut(s) 23, 74
XspI CTAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.