pycom16g25790

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
27936259 .. 27936852
594 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g25790.1

Sequence Viewer

Length: 594 bp
ATGTCTGGCCTATCCGACCGTCGTTTGGACTTGAATGCTGTAGGAGAGGTAGCCATGTCTCTTCAGGATAACATATGGCGCCCATCTTTCTTATCTCCTACTGGTCCCCTTACTATTGGGGACTTTGTGATGAATAATGATATGACCACTGCGGTGGTGGCCAAGAATCTTCTTACTCCCAAAGACAACAGACTACTTTCCAAACGATCCGATGAGTTGGCTGTTAAGGATTCTTTGGCTTTCAGTGTTCAATGTGCAAGTTCTGCGTCTAATATGGCCCAACACCTATTTGCTCGAACTCGCCAAGTTGAATCGTTGGCGACTGAAGTGATAAGTCTCAAACAGGAGATCAGAGGGCTTAAGCACGAGAATCGACAGTTGCACATGCTCGCACATAGCTATTCTACAACCATGAAGAGAAAGCTTGACCAGTTACAGGAATCCGAGGGTCAGATTTTAAATGATCATCAGAGGTTTGTGAGTTTGTTCGAAAGACATTTATTGCCTTCGTCTTCTGGGGCTGTACCACATACTGAAGCTCCAAATCGATCAACATCTGGTGCCTCCTCTTTCTGGGGTTCTGCCCAGTACTGA

Protein Analysis

198

Amino Acids

21.86

Weight (kDa)

7.96

Isoelectric Point (pI)

50.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 78, 560
AciI CCGC 1 cut(s) 152
AclWI GGATC 1 cut(s) 201
AcoI YGGCCR 1 cut(s) 159
AcuI CTGAAG 3 cut(s) 47, 345, 555
AcyI GRCGYC 1 cut(s) 79
AfaI GTAC 2 cut(s) 525, 590
AfiI CCNNNNNNNGG 3 cut(s) 25, 436, 573
AflII CTTAAG 1 cut(s) 359
AgsI TTSAA 3 cut(s) 34, 251, 311
AleI CACNNNNGTG 1 cut(s) 152
AluBI AGCT 3 cut(s) 399, 424, 539
AluI AGCT 3 cut(s) 399, 424, 539
Alw26I GTCTC 2 cut(s) 63, 341
AlwI GGATC 1 cut(s) 201
AoxI GGCC 3 cut(s) 7, 159, 276
AspLEI GCGC 1 cut(s) 81
AspS9I GGNCC 2 cut(s) 104, 277
AsuII TTCGAA 1 cut(s) 489
AvaII GGWCC 1 cut(s) 104
BalI TGGCCA 1 cut(s) 161
BanI GGYRCC 2 cut(s) 78, 560
BauI CACGAG 1 cut(s) 365
BbsI GAAGAC 1 cut(s) 504
BccI CCATC 1 cut(s) 91
BcgI CGANNNNNNTGC 2 cut(s) 353, 387
BclI TGATCA 1 cut(s) 463
BcoDI GTCTC 2 cut(s) 63, 341
BfmI CTRYAG 1 cut(s) 39
BfoI RGCGCY 1 cut(s) 82
BfrI CTTAAG 1 cut(s) 359
BmcAI AGTACT 1 cut(s) 590
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 2 cut(s) 104, 277
BmiI GGNNCC 3 cut(s) 80, 106, 562
BmrI ACTGGG 1 cut(s) 580
BmuI ACTGGG 1 cut(s) 580
BpiI GAAGAC 1 cut(s) 504
Bpu14I TTCGAA 1 cut(s) 489
Bsa29I ATCGAT 1 cut(s) 547
BsaBI GATNNNNATC 1 cut(s) 553
BsaHI GRCGYC 1 cut(s) 79
BsaJI CCNNGG 1 cut(s) 444
BsaXI ACNNNNNCTCC 2 cut(s) 523, 553
Bsc4I CCNNNNNNNGG 3 cut(s) 25, 436, 573
Bse1I ACTGG 3 cut(s) 106, 430, 586
Bse8I GATNNNNATC 1 cut(s) 553
BseCI ATCGAT 1 cut(s) 547
BseDI CCNNGG 1 cut(s) 444
BseJI GATNNNNATC 1 cut(s) 553
BseLI CCNNNNNNNGG 3 cut(s) 25, 436, 573
BseNI ACTGG 3 cut(s) 106, 430, 586
BseRI GAGGAG 1 cut(s) 556
Bsh1285I CGRYCG 1 cut(s) 19
BshFI GGCC 3 cut(s) 9, 161, 278
BshNI GGYRCC 2 cut(s) 78, 560
BshVI ATCGAT 1 cut(s) 547
BsiEI CGRYCG 1 cut(s) 19
BslFI GGGAC 2 cut(s) 90, 134
BslI CCNNNNNNNGG 3 cut(s) 25, 436, 573
BsmAI GTCTC 2 cut(s) 63, 341
BsmFI GGGAC 2 cut(s) 90, 134
BsmI GAATGC 1 cut(s) 40
BsnI GGCC 3 cut(s) 9, 161, 278
Bsp119I TTCGAA 1 cut(s) 489
Bsp143I GATC 4 cut(s) 206, 348, 463, 548
BspACI CCGC 1 cut(s) 152
BspANI GGCC 3 cut(s) 9, 161, 278
BspDI ATCGAT 1 cut(s) 547
BspLI GGNNCC 3 cut(s) 80, 106, 562
BspPI GGATC 1 cut(s) 201
BspT104I TTCGAA 1 cut(s) 489
BspT107I GGYRCC 2 cut(s) 78, 560
BspTI CTTAAG 1 cut(s) 359
BsrI ACTGG 3 cut(s) 106, 430, 586
BssECI CCNNGG 1 cut(s) 444
BssMI GATC 4 cut(s) 206, 348, 463, 548
BssNI GRCGYC 1 cut(s) 79
BssSI CACGAG 1 cut(s) 365
Bst2BI CACGAG 1 cut(s) 365
Bst4CI ACNGT 2 cut(s) 20, 378
Bst6I CTCTTC 2 cut(s) 66, 410
BstACI GRCGYC 1 cut(s) 79
BstAFI CTTAAG 1 cut(s) 359
BstAPI GCANNNNNTGC 1 cut(s) 263
BstBI TTCGAA 1 cut(s) 489
BstC8I GCNNGC 1 cut(s) 390
BstH2I RGCGCY 1 cut(s) 82
BstHHI GCGC 1 cut(s) 81
BstKTI GATC 4 cut(s) 209, 351, 466, 551
BstMAI GTCTC 2 cut(s) 63, 341
BstMBI GATC 4 cut(s) 206, 348, 463, 548
BstMCI CGRYCG 1 cut(s) 19
BstMWI GCNNNNNNNGC 2 cut(s) 158, 263
BstNSI RCATGY 1 cut(s) 388
BstSFI CTRYAG 1 cut(s) 39
BstV2I GAAGAC 1 cut(s) 504
BstXI CCANNNNNNTGG 1 cut(s) 154
Bsu15I ATCGAT 1 cut(s) 547
BsuRI GGCC 3 cut(s) 9, 161, 278
BsuTUI ATCGAT 1 cut(s) 547
BtsI GCAGTG 1 cut(s) 147
BtsIMutI CAGTG 2 cut(s) 147, 250
Cac8I GCNNGC 1 cut(s) 390
CfoI GCGC 1 cut(s) 81
Cfr13I GGNCC 2 cut(s) 104, 277
ClaI ATCGAT 1 cut(s) 547
CseI GACGC 1 cut(s) 255
Csp6I GTAC 2 cut(s) 524, 589
CviAII CATG 3 cut(s) 55, 385, 412
CviQI GTAC 2 cut(s) 524, 589
DinI GGCGCC 1 cut(s) 80
DpnI GATC 4 cut(s) 208, 350, 465, 550
DpnII GATC 4 cut(s) 206, 348, 463, 548
DraI TTTAAA 1 cut(s) 459
EaeI YGGCCR 1 cut(s) 159
Eam1104I CTCTTC 2 cut(s) 66, 410
EarI CTCTTC 2 cut(s) 66, 410
Eco47I GGWCC 1 cut(s) 104
Eco57I CTGAAG 3 cut(s) 47, 345, 555
EgeI GGCGCC 1 cut(s) 80
EheI GGCGCC 1 cut(s) 80
FaeI CATG 3 cut(s) 58, 388, 415
FaiI YATR 9 cut(s) 56, 74, 76, 143, 275, 386, 396, 413, 531
FaqI GGGAC 2 cut(s) 90, 134
FatI CATG 3 cut(s) 54, 384, 411
FauNDI CATATG 1 cut(s) 74
FbaI TGATCA 1 cut(s) 463
GlaI GCGC 1 cut(s) 80
HaeII RGCGCY 1 cut(s) 82
HaeIII GGCC 3 cut(s) 9, 161, 278
HgaI GACGC 1 cut(s) 255
HhaI GCGC 1 cut(s) 81
Hin1I GRCGYC 1 cut(s) 79
Hin1II CATG 3 cut(s) 58, 388, 415
Hin6I GCGC 1 cut(s) 79
HinP1I GCGC 1 cut(s) 79
HindIII AAGCTT 1 cut(s) 422
HinfI GANTC 5 cut(s) 166, 230, 311, 370, 440
Hpy188I TCNGA 6 cut(s) 16, 211, 353, 445, 453, 471
Hpy188III TCNNGA 1 cut(s) 65
Hpy99I CGWCG 1 cut(s) 24
HpyAV CCTTC 1 cut(s) 516
HpyCH4III ACNGT 2 cut(s) 20, 378
HpyCH4V TGCA 2 cut(s) 257, 382
HpyF10VI GCNNNNNNNGC 2 cut(s) 158, 263
Hsp92I GRCGYC 1 cut(s) 79
Hsp92II CATG 3 cut(s) 58, 388, 415
HspAI GCGC 1 cut(s) 79
KasI GGCGCC 1 cut(s) 78
Ksp22I TGATCA 1 cut(s) 463
Kzo9I GATC 4 cut(s) 206, 348, 463, 548
LmnI GCTCC 1 cut(s) 544
LpnPI CCDG 8 cut(s) 50, 87, 329, 422, 443, 501, 543, 559
MaeIII GTNAC 1 cut(s) 432
MalI GATC 4 cut(s) 208, 350, 465, 550
MboI GATC 4 cut(s) 206, 348, 463, 548
MboII GAAGA 4 cut(s) 53, 161, 427, 504
MlsI TGGCCA 1 cut(s) 161
MluNI TGGCCA 1 cut(s) 161
Mly113I GGCGCC 1 cut(s) 79
MmeI TCCRAC 1 cut(s) 39
MnlI CCTC 6 cut(s) 40, 347, 439, 465, 574, 577
Mox20I TGGCCA 1 cut(s) 161
MscI TGGCCA 1 cut(s) 161
MseI TTAA 3 cut(s) 225, 360, 458
MslI CAYNNNNRTG 1 cut(s) 152
Msp20I TGGCCA 1 cut(s) 161
MspCI CTTAAG 1 cut(s) 359
Mva1269I GAATGC 1 cut(s) 40
MwoI GCNNNNNNNGC 2 cut(s) 158, 263
NarI GGCGCC 1 cut(s) 79
NdeI CATATG 1 cut(s) 74
NdeII GATC 4 cut(s) 206, 348, 463, 548
NlaIII CATG 3 cut(s) 58, 388, 415
NlaIV GGNNCC 3 cut(s) 80, 106, 562
NspI RCATGY 1 cut(s) 388
NspV TTCGAA 1 cut(s) 489
OliI CACNNNNGTG 1 cut(s) 152
PctI GAATGC 1 cut(s) 40
PfeI GAWTC 5 cut(s) 166, 230, 311, 370, 440
PluTI GGCGCC 1 cut(s) 82
PspN4I GGNNCC 3 cut(s) 80, 106, 562
PspPI GGNCC 2 cut(s) 104, 277
RsaI GTAC 2 cut(s) 525, 590
RsaNI GTAC 2 cut(s) 524, 589
RseI CAYNNNNRTG 1 cut(s) 152
SaqAI TTAA 3 cut(s) 225, 360, 458
Sau3AI GATC 4 cut(s) 206, 348, 463, 548
Sau96I GGNCC 2 cut(s) 104, 277
ScaI AGTACT 1 cut(s) 590
SetI ASST 6 cut(s) 51, 288, 401, 426, 476, 541
SfcI CTRYAG 1 cut(s) 39
SfoI GGCGCC 1 cut(s) 80
SfuI TTCGAA 1 cut(s) 489
SinI GGWCC 1 cut(s) 104
SmiMI CAYNNNNRTG 1 cut(s) 152
SmlI CTYRAG 1 cut(s) 359
SmoI CTYRAG 1 cut(s) 359
SsiI CCGC 1 cut(s) 152
SspDI GGCGCC 1 cut(s) 78
TaaI ACNGT 2 cut(s) 20, 378
TaqI TCGA 4 cut(s) 295, 373, 489, 547
TatI WGTACW 1 cut(s) 588
TfiI GAWTC 5 cut(s) 166, 230, 311, 370, 440
Tru1I TTAA 3 cut(s) 225, 360, 458
Tru9I TTAA 3 cut(s) 225, 360, 458
TscAI CASTG 2 cut(s) 154, 250
TspDTI ATGAA 2 cut(s) 146, 428
TspRI CASTG 2 cut(s) 154, 250
Vha464I CTTAAG 1 cut(s) 359
VpaK11BI GGWCC 1 cut(s) 104
XceI RCATGY 1 cut(s) 388
XcmI CCANNNNNNNNNTGG 1 cut(s) 154
ZrmI AGTACT 1 cut(s) 590
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.