pycom2339g00100

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00002339
OG0000120
Physical Location & Seq
Reverse (-)
67363 .. 68145
783 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom2339g00100.1

Sequence Viewer

Length: 783 bp
ATGTGGTGGGAACCTCAAAATGCTCAACAAGGAGGATATTGGCAGCCACCACAACCTCATATTCAATATGCCCAACCAAATTTAAGTTCGTCAATAGATTATAATCAAAAGCTTAACGAATTAATTTGTTTGGTGCAGGGCTCACAAAATCAAGACAATGAGGCTCGACAAGAAGACAAAAGGTTGGATCACTTGGAAAAGCAAATTGGGCAGATAGCGGAGTTCGTAGGACAATTTTGCGACCAAGGCAAACTCCCTAGTTCAACCATTGTAAATCCGAAGGGAGGATTTGAAGCACCTTTGCCGGAAGCACTTATTGCTCCTACGCCATCTAATTCAAGTAAGGTTGTTCCAATTAGTTCTAACCCCATTCCCCTTAATATCCCTATTCCTTGCAGGTTCATGAATTCCAAGGAAGAAGAAAGTGAAAAAGACATCTTGGAAGACCTTCCAAAGGTGCAAAGTAGGGAATTTCATGAATTCATCAAAGGGGATATACTTGAGACAACAATGCCCAAAGAAGTTGAATTTGATGACATTGGACAAGTCATAACCATCACATGCAATCTGGCCAAGTCCAATATCCCTGAAACTTTCAAAGGAGTGGTGTTTGTCATTGAGTTCTTGTCAGACAAAACAAGTAAGTCATTTTTTTCAAATTCCATTACATTTTATACTAACTTGTTGTTTTTTATGAATCAGGCACCTACATTAGAATTCAAACCAATGCCGGTTCACTTCAAGTATCACCTTCCATTCAAGGACCAATTCCATGCCGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotrans_gag

Protein Analysis

261

Amino Acids

29.62

Weight (kDa)

5.02

Isoelectric Point (pI)

48.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 102
Acc36I ACCTGC 1 cut(s) 387
AccB1I GGYRCC 1 cut(s) 703
AciI CCGC 1 cut(s) 218
AclWI GGATC 1 cut(s) 195
AcoI YGGCCR 1 cut(s) 570
AcsI RAATTY 7 cut(s) 79, 406, 470, 479, 527, 658, 716
AfiI CCNNNNNNNGG 2 cut(s) 284, 454
AjuI GAANNNNNNNTTGG 4 cut(s) 70, 102, 189, 221
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
Alw26I GTCTC 1 cut(s) 497
AlwI GGATC 1 cut(s) 195
AoxI GGCC 1 cut(s) 570
ApeKI GCWGC 1 cut(s) 43
ApoI RAATTY 7 cut(s) 79, 406, 470, 479, 527, 658, 716
AseI ATTAAT 1 cut(s) 122
Asp700I GAANNNNTTC 1 cut(s) 447
AspS9I GGNCC 1 cut(s) 763
AsuHPI GGTGA 1 cut(s) 740
AvaII GGWCC 1 cut(s) 763
BalI TGGCCA 1 cut(s) 572
BanI GGYRCC 1 cut(s) 703
BanII GRGCYC 1 cut(s) 143
BbsI GAAGAC 2 cut(s) 180, 450
BbvI GCAGC 1 cut(s) 55
BccI CCATC 2 cut(s) 337, 563
BceAI ACGGC 1 cut(s) 761
BcoDI GTCTC 1 cut(s) 497
BfaI CTAG 1 cut(s) 258
BfuAI ACCTGC 1 cut(s) 387
BisI GCNGC 1 cut(s) 44
BlsI GCNGC 1 cut(s) 45
Bme18I GGWCC 1 cut(s) 763
BmgT120I GGNCC 1 cut(s) 763
BmiI GGNNCC 2 cut(s) 12, 705
BpiI GAAGAC 2 cut(s) 180, 450
BpuEI CTTGAG 1 cut(s) 521
BsaBI GATNNNNATC 1 cut(s) 102
BsaJI CCNNGG 2 cut(s) 244, 411
Bsc4I CCNNNNNNNGG 2 cut(s) 284, 454
Bse118I RCCGGY 1 cut(s) 730
Bse8I GATNNNNATC 1 cut(s) 102
BseDI CCNNGG 2 cut(s) 244, 411
BseJI GATNNNNATC 1 cut(s) 102
BseLI CCNNNNNNNGG 2 cut(s) 284, 454
BseXI GCAGC 1 cut(s) 55
BsgI GTGCAG 1 cut(s) 155
BshFI GGCC 1 cut(s) 572
BshNI GGYRCC 1 cut(s) 703
BsiSI CCGG 2 cut(s) 305, 731
BslI CCNNNNNNNGG 2 cut(s) 284, 454
BsmAI GTCTC 1 cut(s) 497
BsnI GGCC 1 cut(s) 572
Bsp1286I GDGCHC 1 cut(s) 143
Bsp143I GATC 1 cut(s) 187
BspACI CCGC 1 cut(s) 218
BspANI GGCC 1 cut(s) 572
BspHI TCATGA 2 cut(s) 402, 475
BspLI GGNNCC 2 cut(s) 12, 705
BspMI ACCTGC 1 cut(s) 387
BspPI GGATC 1 cut(s) 195
BspT107I GGYRCC 1 cut(s) 703
BsrFI RCCGGY 1 cut(s) 730
BssAI RCCGGY 1 cut(s) 730
BssECI CCNNGG 2 cut(s) 244, 411
BssMI GATC 1 cut(s) 187
BssT1I CCWWGG 2 cut(s) 244, 411
BstAPI GCANNNNNTGC 1 cut(s) 317
BstENI CCTNNNNNAGG 1 cut(s) 452
BstKTI GATC 1 cut(s) 190
BstMAI GTCTC 1 cut(s) 497
BstMBI GATC 1 cut(s) 187
BstMWI GCNNNNNNNGC 3 cut(s) 208, 246, 317
BstNSI RCATGY 1 cut(s) 564
BstV1I GCAGC 1 cut(s) 55
BstV2I GAAGAC 2 cut(s) 180, 450
BsuRI GGCC 1 cut(s) 572
BveI ACCTGC 1 cut(s) 387
CciI TCATGA 2 cut(s) 402, 475
Cfr10I RCCGGY 1 cut(s) 730
Cfr13I GGNCC 1 cut(s) 763
CviAII CATG 4 cut(s) 403, 476, 561, 773
CviJI RGCY 5 cut(s) 46, 112, 141, 164, 572
CviKI_1 RGCY 5 cut(s) 46, 112, 141, 164, 572
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
EaeI YGGCCR 1 cut(s) 570
Eco130I CCWWGG 2 cut(s) 244, 411
Eco24I GRGCYC 1 cut(s) 143
Eco47I GGWCC 1 cut(s) 763
EcoNI CCTNNNNNAGG 1 cut(s) 452
EcoRI GAATTC 3 cut(s) 406, 479, 716
EcoT14I CCWWGG 2 cut(s) 244, 411
EcoT38I GRGCYC 1 cut(s) 143
ErhI CCWWGG 2 cut(s) 244, 411
FaeI CATG 4 cut(s) 406, 479, 564, 776
FatI CATG 4 cut(s) 402, 475, 560, 772
Fnu4HI GCNGC 1 cut(s) 44
FriOI GRGCYC 1 cut(s) 143
Fsp4HI GCNGC 1 cut(s) 44
FspBI CTAG 1 cut(s) 258
GluI GCNGC 1 cut(s) 44
HaeIII GGCC 1 cut(s) 572
HapII CCGG 2 cut(s) 305, 731
Hin1II CATG 4 cut(s) 406, 479, 564, 776
HindIII AAGCTT 1 cut(s) 110
HinfI GANTC 1 cut(s) 697
HpaII CCGG 2 cut(s) 305, 731
HphI GGTGA 1 cut(s) 740
Hpy166II GTNNAC 1 cut(s) 736
Hpy188I TCNGA 2 cut(s) 279, 631
Hpy188III TCNNGA 3 cut(s) 152, 403, 476
Hpy8I GTNNAC 1 cut(s) 736
HpyAV CCTTC 3 cut(s) 274, 458, 761
HpyCH4V TGCA 4 cut(s) 136, 396, 460, 564
HpyF10VI GCNNNNNNNGC 3 cut(s) 208, 246, 317
Hsp92II CATG 4 cut(s) 406, 479, 564, 776
Kzo9I GATC 1 cut(s) 187
LmnI GCTCC 1 cut(s) 325
LpnPI CCDG 7 cut(s) 122, 318, 382, 554, 600, 686, 744
Lsp1109I GCAGC 1 cut(s) 55
MaeI CTAG 1 cut(s) 258
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MboII GAAGA 4 cut(s) 185, 428, 431, 455
MhlI GDGCHC 1 cut(s) 143
MlsI TGGCCA 1 cut(s) 572
MluNI TGGCCA 1 cut(s) 572
MmeI TCCRAC 1 cut(s) 165
MnlI CCTC 5 cut(s) 24, 26, 66, 154, 278
Mox20I TGGCCA 1 cut(s) 572
MroXI GAANNNNTTC 1 cut(s) 447
MscI TGGCCA 1 cut(s) 572
MseI TTAA 4 cut(s) 83, 114, 122, 378
Msp20I TGGCCA 1 cut(s) 572
MspI CCGG 2 cut(s) 305, 731
MwoI GCNNNNNNNGC 3 cut(s) 208, 246, 317
NdeII GATC 1 cut(s) 187
NlaIII CATG 4 cut(s) 406, 479, 564, 776
NlaIV GGNNCC 2 cut(s) 12, 705
NspI RCATGY 1 cut(s) 564
PagI TCATGA 2 cut(s) 402, 475
PdmI GAANNNNTTC 1 cut(s) 447
PfeI GAWTC 1 cut(s) 697
PkrI GCNGC 1 cut(s) 45
PshBI ATTAAT 1 cut(s) 122
PsiI TTATAA 1 cut(s) 102
PspN4I GGNNCC 2 cut(s) 12, 705
PspPI GGNCC 1 cut(s) 763
SaqAI TTAA 4 cut(s) 83, 114, 122, 378
SatI GCNGC 1 cut(s) 44
Sau3AI GATC 1 cut(s) 187
Sau96I GGNCC 1 cut(s) 763
SduI GDGCHC 1 cut(s) 143
SinI GGWCC 1 cut(s) 763
SmlI CTYRAG 1 cut(s) 500
SmoI CTYRAG 1 cut(s) 500
SsiI CCGC 1 cut(s) 218
SspMI CTAG 1 cut(s) 258
StyI CCWWGG 2 cut(s) 244, 411
TaqI TCGA 1 cut(s) 166
TfiI GAWTC 1 cut(s) 697
Tru1I TTAA 4 cut(s) 83, 114, 122, 378
Tru9I TTAA 4 cut(s) 83, 114, 122, 378
TseI GCWGC 1 cut(s) 43
TspDTI ATGAA 6 cut(s) 391, 419, 464, 472, 492, 710
VpaK11BI GGWCC 1 cut(s) 763
VspI ATTAAT 1 cut(s) 122
XagI CCTNNNNNAGG 1 cut(s) 452
XapI RAATTY 7 cut(s) 79, 406, 470, 479, 527, 658, 716
XceI RCATGY 1 cut(s) 564
XmnI GAANNNNTTC 1 cut(s) 447
XspI CTAG 1 cut(s) 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.