pycom889g00030

Zinc finger MYM-type protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000889
OG0000120
Physical Location & Seq
Forward (+)
52956 .. 53331
376 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom889g00030.2

Sequence Viewer

Length: 312 bp
ATGAATCAGGCACCTACACTAGAATTCAAACCAATGCCGGTTCACTTCAAGTATCACCTTCCATTCAAGGACCAATTCCATACTAAACATGGAGAAAGATGGTGCCTTCACAGAGGTTGTTTACGTGAAGCCCCACTACGAGGCGTCGAAGCAGAAGGCATAGAAGCGGAAGGCATAGAAGCGGAAGGCATCGGAGCAGAAGACATAGGAGCGGAAGGCATCGGAGCGGGAGGCATCGGAGCTAGAGCATTCCAGGCCTCAATACTTGGCCAAACGCTGGATGACCCAGGAAAAAGGTGCCTCTGGAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

104

Amino Acids

11.29

Weight (kDa)

5.92

Isoelectric Point (pI)

37.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 3 cut(s) 10, 102, 297
AccB7I CCANNNNNTGG 1 cut(s) 277
AccBSI CCGCTC 2 cut(s) 212, 227
AciI CCGC 4 cut(s) 167, 182, 212, 227
AcoI YGGCCR 1 cut(s) 268
AcsI RAATTY 1 cut(s) 23
AcyI GRCGYC 1 cut(s) 144
AfiI CCNNNNNNNGG 2 cut(s) 140, 277
AgsI TTSAA 3 cut(s) 28, 49, 67
AjnI CCWGG 2 cut(s) 252, 286
AluBI AGCT 1 cut(s) 242
AluI AGCT 1 cut(s) 242
AoxI GGCC 2 cut(s) 255, 268
ApoI RAATTY 1 cut(s) 23
AspS9I GGNCC 1 cut(s) 70
AsuHPI GGTGA 1 cut(s) 47
AvaII GGWCC 1 cut(s) 70
BalI TGGCCA 1 cut(s) 270
BanI GGYRCC 3 cut(s) 10, 102, 297
BarI GAAGNNNNNNTAC 2 cut(s) 120, 152
BbsI GAAGAC 1 cut(s) 207
BccI CCATC 1 cut(s) 93
BciT130I CCWGG 2 cut(s) 254, 288
BfaI CTAG 2 cut(s) 20, 243
Bme1390I CCNGG 2 cut(s) 254, 288
Bme18I GGWCC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 70
BmiI GGNNCC 3 cut(s) 12, 104, 299
BmrFI CCNGG 2 cut(s) 254, 288
BmsI GCATC 3 cut(s) 198, 228, 243
BpiI GAAGAC 1 cut(s) 207
BsaAI YACGTR 1 cut(s) 125
BsaHI GRCGYC 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 286
Bsc4I CCNNNNNNNGG 2 cut(s) 140, 277
Bse118I RCCGGY 1 cut(s) 37
BseBI CCWGG 2 cut(s) 254, 288
BseDI CCNNGG 1 cut(s) 286
BseGI GGATG 1 cut(s) 286
BseLI CCNNNNNNNGG 2 cut(s) 140, 277
BshFI GGCC 2 cut(s) 257, 270
BshNI GGYRCC 3 cut(s) 10, 102, 297
BsiSI CCGG 1 cut(s) 38
BslI CCNNNNNNNGG 2 cut(s) 140, 277
BsmI GAATGC 1 cut(s) 248
BsnI GGCC 2 cut(s) 257, 270
BspACI CCGC 4 cut(s) 167, 182, 212, 227
BspANI GGCC 2 cut(s) 257, 270
BspLI GGNNCC 3 cut(s) 12, 104, 299
BspT107I GGYRCC 3 cut(s) 10, 102, 297
BsrBI CCGCTC 2 cut(s) 212, 227
BsrFI RCCGGY 1 cut(s) 37
BssAI RCCGGY 1 cut(s) 37
BssECI CCNNGG 1 cut(s) 286
BssNI GRCGYC 1 cut(s) 144
Bst2UI CCWGG 2 cut(s) 254, 288
BstACI GRCGYC 1 cut(s) 144
BstBAI YACGTR 1 cut(s) 125
BstF5I GGATG 1 cut(s) 286
BstMWI GCNNNNNNNGC 1 cut(s) 254
BstNI CCWGG 2 cut(s) 254, 288
BstSCI CCNGG 2 cut(s) 252, 286
BstV2I GAAGAC 1 cut(s) 207
BsuRI GGCC 2 cut(s) 257, 270
BtsCI GGATG 1 cut(s) 286
Cfr10I RCCGGY 1 cut(s) 37
Cfr13I GGNCC 1 cut(s) 70
CseI GACGC 1 cut(s) 133
CviAII CATG 1 cut(s) 89
CviJI RGCY 4 cut(s) 131, 242, 257, 270
CviKI_1 RGCY 4 cut(s) 131, 242, 257, 270
EaeI YGGCCR 1 cut(s) 268
Eco147I AGGCCT 1 cut(s) 257
Eco47I GGWCC 1 cut(s) 70
EcoRI GAATTC 1 cut(s) 23
EcoRII CCWGG 2 cut(s) 252, 286
FaeI CATG 1 cut(s) 92
FaiI YATR 5 cut(s) 81, 90, 161, 176, 206
FatI CATG 1 cut(s) 88
FauI CCCGC 1 cut(s) 220
FokI GGATG 1 cut(s) 293
FspBI CTAG 2 cut(s) 20, 243
HaeIII GGCC 2 cut(s) 257, 270
HapII CCGG 1 cut(s) 38
HgaI GACGC 1 cut(s) 133
Hin1I GRCGYC 1 cut(s) 144
Hin1II CATG 1 cut(s) 92
HinfI GANTC 1 cut(s) 4
HpaII CCGG 1 cut(s) 38
HphI GGTGA 1 cut(s) 47
Hpy166II GTNNAC 2 cut(s) 43, 122
Hpy188I TCNGA 3 cut(s) 194, 224, 239
Hpy188III TCNNGA 1 cut(s) 304
Hpy8I GTNNAC 2 cut(s) 43, 122
Hpy99I CGWCG 1 cut(s) 149
HpyAV CCTTC 6 cut(s) 68, 116, 149, 164, 179, 209
HpyCH4IV ACGT 1 cut(s) 124
HpyF10VI GCNNNNNNNGC 1 cut(s) 254
HpySE526I ACGT 1 cut(s) 124
Hsp92I GRCGYC 1 cut(s) 144
Hsp92II CATG 1 cut(s) 92
LmnI GCTCC 4 cut(s) 194, 209, 224, 239
LpnPI CCDG 7 cut(s) 51, 239, 263, 266, 273, 289, 300
LweI GCATC 3 cut(s) 198, 228, 243
MaeI CTAG 2 cut(s) 20, 243
MaeII ACGT 1 cut(s) 124
MbiI CCGCTC 2 cut(s) 212, 227
MboII GAAGA 1 cut(s) 212
MlsI TGGCCA 1 cut(s) 270
MluCI AATT 2 cut(s) 23, 74
MluNI TGGCCA 1 cut(s) 270
MnlI CCTC 5 cut(s) 107, 134, 224, 268, 311
Mox20I TGGCCA 1 cut(s) 270
MscI TGGCCA 1 cut(s) 270
Msp20I TGGCCA 1 cut(s) 270
MspI CCGG 1 cut(s) 38
MspR9I CCNGG 2 cut(s) 254, 288
Mva1269I GAATGC 1 cut(s) 248
MvaI CCWGG 2 cut(s) 254, 288
MwoI GCNNNNNNNGC 1 cut(s) 254
NlaIII CATG 1 cut(s) 92
NlaIV GGNNCC 3 cut(s) 12, 104, 299
PceI AGGCCT 1 cut(s) 257
PctI GAATGC 1 cut(s) 248
PfeI GAWTC 1 cut(s) 4
PflMI CCANNNNNTGG 1 cut(s) 277
Ppu21I YACGTR 1 cut(s) 125
Psp6I CCWGG 2 cut(s) 252, 286
PspGI CCWGG 2 cut(s) 252, 286
PspN4I GGNNCC 3 cut(s) 12, 104, 299
PspPI GGNCC 1 cut(s) 70
Sau96I GGNCC 1 cut(s) 70
ScrFI CCNGG 2 cut(s) 254, 288
SetI ASST 6 cut(s) 16, 60, 118, 127, 244, 299
SfaNI GCATC 3 cut(s) 198, 228, 243
SinI GGWCC 1 cut(s) 70
Sse9I AATT 2 cut(s) 23, 74
SseBI AGGCCT 1 cut(s) 257
SsiI CCGC 4 cut(s) 167, 182, 212, 227
SspMI CTAG 2 cut(s) 20, 243
StuI AGGCCT 1 cut(s) 257
StyD4I CCNGG 2 cut(s) 252, 286
TaiI ACGT 1 cut(s) 127
TaqI TCGA 1 cut(s) 147
TasI AATT 2 cut(s) 23, 74
TfiI GAWTC 1 cut(s) 4
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 277
VpaK11BI GGWCC 1 cut(s) 70
XapI RAATTY 1 cut(s) 23
XcmI CCANNNNNNNNNTGG 1 cut(s) 86
XspI CTAG 2 cut(s) 20, 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.