Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00012633

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

90591 .. 101573

Gene Structure 10983 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12633g00040.4

Sequence Viewer

CDS Protein Promoter (2k)

Length: 723 bp

ATGGAGGCAAACTCATCGAACCTTAGCTTGGAATTGAGCCTTAGCAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGAGCCCTTCTTTCTTATCTTCTAACGGTCTTCTTACAGGTGAAGACTCCGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTACTTGCCCGCTCCCCTCAGGTGGAATCATTGATGGCAGAGGTGGAGAGTCTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCATCTTCTTCCTGGATCATCGAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTTCGATGCCTTCTGCTTCTGCGCCTCGTAGTGGGGCTTCACGTAAACAACCTTTGAAGGTATGGTGGGGAAGAGTGATGGAAATGGAAAGATGGTTTTGGATTCTAAGGGGACTCACGGCAAAGAGAAGGAATGGAAGTGTTTGTGGTGTGTTGTGTATGAAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

241

Amino Acids

26.54

Weight (kDa)

9.33

Isoelectric Point (pI)

61.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	300
AccII	CGCG	2 cut(s)	59, 64
AciI	CCGC	2 cut(s)	62, 298
AclWI	GGATC	2 cut(s)	346, 520
AcoI	YGGCCR	2 cut(s)	222, 527
AcsI	RAATTY	1 cut(s)	456
AcyI	GRCGYC	1 cut(s)	141
AdeI	CACNNNGTG	1 cut(s)	248
AfaI	GTAC	1 cut(s)	368
AfeI	AGCGCT	1 cut(s)	523
AfiI	CCNNNNNNNGG	4 cut(s)	28, 68, 310, 587
AflII	CTTAAG	2 cut(s)	341, 362
AgsI	TTSAA	2 cut(s)	230, 613
AjnI	CCWGG	2 cut(s)	508, 542
AjuI	GAANNNNNNNTTGG	2 cut(s)	11, 43
AluBI	AGCT	7 cut(s)	27, 152, 164, 361, 427, 436, 557
AluI	AGCT	7 cut(s)	27, 152, 164, 361, 427, 436, 557
AlwI	GGATC	2 cut(s)	346, 520
Aor51HI	AGCGCT	1 cut(s)	523
AoxI	GGCC	4 cut(s)	222, 280, 527, 540
ApeKI	GCWGC	3 cut(s)	196, 358, 436
ApoI	RAATTY	1 cut(s)	456
AscI	GGCGCGCC	1 cut(s)	57
AspLEI	GCGC	4 cut(s)	59, 61, 524, 580
AspS9I	GGNCC	2 cut(s)	210, 280
AsuHPI	GGTGA	1 cut(s)	131
AvaII	GGWCC	1 cut(s)	210
AxyI	CCTNAGG	1 cut(s)	306
BalI	TGGCCA	1 cut(s)	529
BanII	GRGCYC	1 cut(s)	86
BarI	GAAGNNNNNNTAC	2 cut(s)	577, 609
BbsI	GAAGAC	2 cut(s)	101, 129
BbvI	GCAGC	3 cut(s)	183, 370, 423
BccI	CCATC	3 cut(s)	316, 628, 642
BceAI	ACGGC	2 cut(s)	209, 690
BcgI	CGANNNNNNTGC	1 cut(s)	31
BciT130I	CCWGG	2 cut(s)	510, 544
BfaI	CTAG	2 cut(s)	165, 554
BfoI	RGCGCY	1 cut(s)	525
BfrI	CTTAAG	2 cut(s)	341, 362
BisI	GCNGC	4 cut(s)	62, 197, 359, 437
BlsI	GCNGC	4 cut(s)	63, 198, 360, 438
Bme1390I	CCNGG	2 cut(s)	510, 544
Bme18I	GGWCC	1 cut(s)	210
BmgT120I	GGNCC	2 cut(s)	210, 280
BmiI	GGNNCC	2 cut(s)	83, 170
BmrFI	CCNGG	2 cut(s)	510, 544
BmsI	GCATC	3 cut(s)	123, 508, 552
BpiI	GAAGAC	2 cut(s)	101, 129
BplI	GAGNNNNNCTC	1 cut(s)	28
BpmI	CTGGAG	1 cut(s)	476
Bpu10I	CCTNAGC	2 cut(s)	23, 41
BsaAI	YACGTR	1 cut(s)	599
BsaHI	GRCGYC	1 cut(s)	141
Bsc4I	CCNNNNNNNGG	4 cut(s)	28, 68, 310, 587
Bse21I	CCTNAGG	1 cut(s)	306
BseBI	CCWGG	2 cut(s)	510, 544
BseLI	CCNNNNNNNGG	4 cut(s)	28, 68, 310, 587
BseMII	CTCAG	2 cut(s)	320, 438
BsePI	GCGCGC	1 cut(s)	57
BseRI	GAGGAG	1 cut(s)	164
BseXI	GCAGC	3 cut(s)	183, 370, 423
Bsh1236I	CGCG	2 cut(s)	59, 64
BshFI	GGCC	4 cut(s)	224, 282, 529, 542
BslFI	GGGAC	2 cut(s)	220, 681
BslI	CCNNNNNNNGG	4 cut(s)	28, 68, 310, 587
BsmFI	GGGAC	2 cut(s)	220, 681
BsmI	GAATGC	1 cut(s)	553
BsnI	GGCC	4 cut(s)	224, 282, 529, 542
Bsp1286I	GDGCHC	1 cut(s)	86
Bsp143I	GATC	2 cut(s)	351, 512
BspACI	CCGC	2 cut(s)	62, 298
BspANI	GGCC	4 cut(s)	224, 282, 529, 542
BspCNI	CTCAG	2 cut(s)	319, 439
BspFNI	CGCG	2 cut(s)	59, 64
BspLI	GGNNCC	2 cut(s)	83, 170
BspPI	GGATC	2 cut(s)	346, 520
BspTI	CTTAAG	2 cut(s)	341, 362
BsrBI	CCGCTC	1 cut(s)	300
BssHII	GCGCGC	1 cut(s)	57
BssMI	GATC	2 cut(s)	351, 512
BssNI	GRCGYC	1 cut(s)	141
Bst2UI	CCWGG	2 cut(s)	510, 544
Bst4CI	ACNGT	4 cut(s)	107, 210, 464, 470
Bst6I	CTCTTC	2 cut(s)	413, 622
BstACI	GRCGYC	1 cut(s)	141
BstAFI	CTTAAG	2 cut(s)	341, 362
BstBAI	YACGTR	1 cut(s)	599
BstC8I	GCNNGC	3 cut(s)	59, 298, 393
BstDEI	CTNAG	6 cut(s)	23, 41, 245, 306, 447, 662
BstFNI	CGCG	2 cut(s)	59, 64
BstH2I	RGCGCY	1 cut(s)	525
BstHHI	GCGC	4 cut(s)	59, 61, 524, 580
BstKTI	GATC	2 cut(s)	354, 515
BstMBI	GATC	2 cut(s)	351, 512
BstMWI	GCNNNNNNNGC	3 cut(s)	149, 433, 548
BstNI	CCWGG	2 cut(s)	510, 544
BstNSI	RCATGY	1 cut(s)	389
BstSCI	CCNGG	2 cut(s)	508, 542
BstUI	CGCG	2 cut(s)	59, 64
BstV1I	GCAGC	3 cut(s)	183, 370, 423
BstV2I	GAAGAC	2 cut(s)	101, 129
BstX2I	RGATCY	1 cut(s)	351
BstYI	RGATCY	1 cut(s)	351
Bsu36I	CCTNAGG	1 cut(s)	306
BsuRI	GGCC	4 cut(s)	224, 282, 529, 542
BtsI	GCAGTG	1 cut(s)	52
BtsIMutI	CAGTG	3 cut(s)	52, 260, 469
Cac8I	GCNNGC	3 cut(s)	59, 298, 393
CfoI	GCGC	4 cut(s)	59, 61, 524, 580
Cfr13I	GGNCC	2 cut(s)	210, 280
CpoI	CGGWCCG	1 cut(s)	210
CseI	GACGC	2 cut(s)	53, 149
Csp6I	GTAC	1 cut(s)	367
CspI	CGGWCCG	1 cut(s)	210
CviAII	CATG	3 cut(s)	277, 386, 415
CviQI	GTAC	1 cut(s)	367
DdeI	CTNAG	6 cut(s)	23, 41, 245, 306, 447, 662
DpnI	GATC	2 cut(s)	353, 514
DpnII	GATC	2 cut(s)	351, 512
DraIII	CACNNNGTG	1 cut(s)	248
EaeI	YGGCCR	2 cut(s)	222, 527
Eam1104I	CTCTTC	2 cut(s)	413, 622
EarI	CTCTTC	2 cut(s)	413, 622
Eco147I	AGGCCT	1 cut(s)	542
Eco24I	GRGCYC	1 cut(s)	86
Eco47I	GGWCC	1 cut(s)	210
Eco47III	AGCGCT	1 cut(s)	523
Eco81I	CCTNAGG	1 cut(s)	306
EcoRI	GAATTC	1 cut(s)	456
EcoRII	CCWGG	2 cut(s)	508, 542
EcoT38I	GRGCYC	1 cut(s)	86
FaeI	CATG	3 cut(s)	280, 389, 418
FaiI	YATR	6 cut(s)	79, 278, 387, 416, 619, 716
FaqI	GGGAC	2 cut(s)	220, 681
FatI	CATG	3 cut(s)	276, 385, 414
FauI	CCCGC	1 cut(s)	305
Fnu4HI	GCNGC	4 cut(s)	62, 197, 359, 437
FriOI	GRGCYC	1 cut(s)	86
Fsp4HI	GCNGC	4 cut(s)	62, 197, 359, 437
FspBI	CTAG	2 cut(s)	165, 554
GlaI	GCGC	4 cut(s)	58, 60, 523, 579
GluI	GCNGC	4 cut(s)	62, 197, 359, 437
GsuI	CTGGAG	1 cut(s)	476
HaeII	RGCGCY	1 cut(s)	525
HaeIII	GGCC	4 cut(s)	224, 282, 529, 542
HgaI	GACGC	2 cut(s)	53, 149
HhaI	GCGC	4 cut(s)	59, 61, 524, 580
Hin1I	GRCGYC	1 cut(s)	141
Hin1II	CATG	3 cut(s)	280, 389, 418
Hin6I	GCGC	4 cut(s)	57, 59, 522, 578
HinP1I	GCGC	4 cut(s)	57, 59, 522, 578
HindIII	AAGCTT	1 cut(s)	425
HinfI	GANTC	7 cut(s)	125, 233, 314, 337, 443, 658, 669
HphI	GGTGA	1 cut(s)	131
Hpy166II	GTNNAC	1 cut(s)	602
Hpy188I	TCNGA	2 cut(s)	214, 448
Hpy188III	TCNNGA	3 cut(s)	204, 230, 493
Hpy8I	GTNNAC	1 cut(s)	602
Hpy99I	CGWCG	1 cut(s)	412
HpyAV	CCTTC	4 cut(s)	96, 576, 607, 678
HpyCH4III	ACNGT	4 cut(s)	107, 210, 464, 470
HpyCH4IV	ACGT	2 cut(s)	75, 598
HpyCH4V	TGCA	4 cut(s)	136, 385, 395, 439
HpyF10VI	GCNNNNNNNGC	3 cut(s)	149, 433, 548
HpyF3I	CTNAG	6 cut(s)	23, 41, 245, 306, 447, 662
HpySE526I	ACGT	2 cut(s)	75, 598
Hsp92I	GRCGYC	1 cut(s)	141
Hsp92II	CATG	3 cut(s)	280, 389, 418
HspAI	GCGC	4 cut(s)	57, 59, 522, 578
Kzo9I	GATC	2 cut(s)	351, 512
LmnI	GCTCC	2 cut(s)	81, 305
Lsp1109I	GCAGC	3 cut(s)	183, 370, 423
LweI	GCATC	3 cut(s)	123, 508, 552
MaeI	CTAG	2 cut(s)	165, 554
MaeII	ACGT	2 cut(s)	75, 598
MaeIII	GTNAC	2 cut(s)	71, 464
MalI	GATC	2 cut(s)	353, 514
MbiI	CCGCTC	1 cut(s)	300
MboI	GATC	2 cut(s)	351, 512
MboII	GAAGA	7 cut(s)	90, 101, 134, 430, 494, 497, 639
MflI	RGATCY	1 cut(s)	351
MhlI	GDGCHC	1 cut(s)	86
MlsI	TGGCCA	1 cut(s)	529
MluCI	AATT	2 cut(s)	32, 456
MluNI	TGGCCA	1 cut(s)	529
MlyI	GAGTC	4 cut(s)	119, 242, 346, 663
MmeI	TCCRAC	1 cut(s)	297
Mox20I	TGGCCA	1 cut(s)	529
MscI	TGGCCA	1 cut(s)	529
MseI	TTAA	2 cut(s)	342, 363
Msp20I	TGGCCA	1 cut(s)	529
MspCI	CTTAAG	2 cut(s)	341, 362
MspR9I	CCNGG	2 cut(s)	510, 544
Mva1269I	GAATGC	1 cut(s)	553
MvaI	CCWGG	2 cut(s)	510, 544
MvnI	CGCG	2 cut(s)	59, 64
MwoI	GCNNNNNNNGC	3 cut(s)	149, 433, 548
NdeII	GATC	2 cut(s)	351, 512
NlaIII	CATG	3 cut(s)	280, 389, 418
NlaIV	GGNNCC	2 cut(s)	83, 170
NmuCI	GTSAC	1 cut(s)	464
NspI	RCATGY	1 cut(s)	389
PalAI	GGCGCGCC	1 cut(s)	57
PauI	GCGCGC	1 cut(s)	57
PceI	AGGCCT	1 cut(s)	542
PctI	GAATGC	1 cut(s)	553
PfeI	GAWTC	3 cut(s)	314, 443, 658
PfoI	TCCNGGA	1 cut(s)	508
PkrI	GCNGC	4 cut(s)	63, 198, 360, 438
PleI	GAGTC	4 cut(s)	119, 241, 345, 663
PpsI	GAGTC	4 cut(s)	119, 241, 345, 663
Ppu21I	YACGTR	1 cut(s)	599
Psp6I	CCWGG	2 cut(s)	508, 542
PspGI	CCWGG	2 cut(s)	508, 542
PspN4I	GGNNCC	2 cut(s)	83, 170
PspPI	GGNCC	2 cut(s)	210, 280
PsuI	RGATCY	1 cut(s)	351
PteI	GCGCGC	1 cut(s)	57
RsaI	GTAC	1 cut(s)	368
RsaNI	GTAC	1 cut(s)	367
Rsr2I	CGGWCCG	1 cut(s)	210
RsrII	CGGWCCG	1 cut(s)	210
SaqAI	TTAA	2 cut(s)	342, 363
SatI	GCNGC	4 cut(s)	62, 197, 359, 437
Sau3AI	GATC	2 cut(s)	351, 512
Sau96I	GGNCC	2 cut(s)	210, 280
SchI	GAGTC	4 cut(s)	119, 242, 346, 663
ScrFI	CCNGG	2 cut(s)	510, 544
SduI	GDGCHC	1 cut(s)	86
SfaNI	GCATC	3 cut(s)	123, 508, 552
SgsI	GGCGCGCC	1 cut(s)	57
SinI	GGWCC	1 cut(s)	210
SmlI	CTYRAG	2 cut(s)	341, 362
SmoI	CTYRAG	2 cut(s)	341, 362
Sse9I	AATT	2 cut(s)	32, 456
SseBI	AGGCCT	1 cut(s)	542
SsiI	CCGC	2 cut(s)	62, 298
SspMI	CTAG	2 cut(s)	165, 554
StuI	AGGCCT	1 cut(s)	542
StyD4I	CCNGG	2 cut(s)	508, 542
TaaI	ACNGT	4 cut(s)	107, 210, 464, 470
TaiI	ACGT	2 cut(s)	78, 601
TaqI	TCGA	4 cut(s)	17, 454, 518, 560
TasI	AATT	2 cut(s)	32, 456
TauI	GCSGC	1 cut(s)	64
TfiI	GAWTC	3 cut(s)	314, 443, 658
Tru1I	TTAA	2 cut(s)	342, 363
Tru9I	TTAA	2 cut(s)	342, 363
TscAI	CASTG	3 cut(s)	52, 260, 469
TseFI	GTSAC	1 cut(s)	464
TseI	GCWGC	3 cut(s)	196, 358, 436
Tsp45I	GTSAC	1 cut(s)	464
TspDTI	ATGAA	1 cut(s)	431
TspGWI	ACGGA	1 cut(s)	118
TspRI	CASTG	3 cut(s)	52, 260, 469
Vha464I	CTTAAG	2 cut(s)	341, 362
VpaK11BI	GGWCC	1 cut(s)	210
XapI	RAATTY	1 cut(s)	456
XceI	RCATGY	1 cut(s)	389
XspI	CTAG	2 cut(s)	165, 554

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.