Prupe.7G095500_v2.0.a1

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
12783591 .. 12786862
3272 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G095500.1

Sequence Viewer

Length: 723 bp
ATGGCAGAGCAAAATTTGGTTGATGAATATCAGTGTGACATCAAAAGATTGAAAAAGAATAGGGCAAAGACAGCAGAGAAGAACCAACGCCAGCTTCAAATATTGCAGGAAGAAAACGAAAAGCTATCAAAGATGGTAGATTCTTATTCTAAAGGCATGCAAAAACAGCTGGAGGCCTTGGAGAACCCAAAGAAGCGCAAGCGAGATCACGAGACAAGTTTTGCTCAAGCTAAGAAAGTGATCTTTGGGAGCTCAAGTGATGAGCCCCAAGAAGTGCTAAATCGATGCAACAGTACATCATTACCAAGTCAAAGAAAAGCCTCAAAGCTTGATGGCAAGCTGTATTTTTCTAGTGGACTCTCTAAGAGCTCTACGCCTGATAGCAATCCAGACATATGTAAGGATTACAAAGACACTGGTTACTGTGGGTATGGAGATTCTTGCAAGTTTATGCATGATCGTGGAGACTACAAGTCTGGGTGGCAGATGGAAAGGGAACAGAGGAAGATGATGATGATGATGATGATGAGGATGGCTCGTTGCCATTTGCATGTTTCATCTGCCGGCAACCATTATCCTGTTGTGACTAAATGCAACCACTACTTCTGCGAGCACTGTACACTAAAGCATCATTCAAAGAACAAGAAGTGCTTTGTGTGCAACAAGCCTACTCTTGGCATATTCAGTACGGTTTATGAGATACGCAGAAGGATGGCTGCATAG

Protein Analysis

241

Amino Acids

27.87

Weight (kDa)

9.36

Isoelectric Point (pI)

46.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 13
AfaI GTAC 3 cut(s) 295, 619, 688
AfiI CCNNNNNNNGG 1 cut(s) 674
AgsI TTSAA 3 cut(s) 52, 98, 636
AhdI GACNNNNNGTC 1 cut(s) 472
AjuI GAANNNNNNNTTGG 2 cut(s) 78, 110
AluBI AGCT 8 cut(s) 94, 124, 169, 230, 252, 328, 340, 369
AluI AGCT 8 cut(s) 94, 124, 169, 230, 252, 328, 340, 369
Alw21I GWGCWC 3 cut(s) 254, 371, 615
Alw26I GTCTC 2 cut(s) 206, 459
AoxI GGCC 1 cut(s) 174
ApeKI GCWGC 1 cut(s) 716
ApoI RAATTY 1 cut(s) 13
AspLEI GCGC 1 cut(s) 198
BanII GRGCYC 3 cut(s) 254, 267, 371
BauI CACGAG 1 cut(s) 209
Bbv12I GWGCWC 3 cut(s) 254, 371, 615
BbvI GCAGC 1 cut(s) 703
BccI CCATC 5 cut(s) 127, 326, 481, 526, 706
BcoDI GTCTC 2 cut(s) 206, 459
BfaI CTAG 1 cut(s) 351
BisI GCNGC 1 cut(s) 717
BlsI GCNGC 1 cut(s) 718
BmeRI GACNNNNNGTC 1 cut(s) 472
BmsI GCATC 2 cut(s) 275, 637
BplI GAGNNNNNCTC 2 cut(s) 520, 552
BpmI CTGGAG 1 cut(s) 191
BpuEI CTTGAG 2 cut(s) 210, 238
Bsa29I ATCGAT 1 cut(s) 283
BsaBI GATNNNNATC 2 cut(s) 27, 384
BsaJI CCNNGG 1 cut(s) 177
BsaXI ACNNNNNCTCC 2 cut(s) 241, 271
Bsc4I CCNNNNNNNGG 1 cut(s) 674
Bse118I RCCGGY 1 cut(s) 563
Bse1I ACTGG 1 cut(s) 421
Bse8I GATNNNNATC 2 cut(s) 27, 384
BseCI ATCGAT 1 cut(s) 283
BseDI CCNNGG 1 cut(s) 177
BseGI GGATG 2 cut(s) 537, 717
BseJI GATNNNNATC 2 cut(s) 27, 384
BseLI CCNNNNNNNGG 1 cut(s) 674
BseNI ACTGG 1 cut(s) 421
BseXI GCAGC 1 cut(s) 703
BshFI GGCC 1 cut(s) 176
BshVI ATCGAT 1 cut(s) 283
BsiHKAI GWGCWC 3 cut(s) 254, 371, 615
BsiSI CCGG 1 cut(s) 564
BslI CCNNNNNNNGG 1 cut(s) 674
BsmAI GTCTC 2 cut(s) 206, 459
BsnI GGCC 1 cut(s) 176
Bsp1286I GDGCHC 4 cut(s) 254, 267, 371, 615
Bsp1407I TGTACA 1 cut(s) 617
Bsp143I GATC 3 cut(s) 205, 240, 457
BspANI GGCC 1 cut(s) 176
BspDI ATCGAT 1 cut(s) 283
BsrFI RCCGGY 1 cut(s) 563
BsrGI TGTACA 1 cut(s) 617
BsrI ACTGG 1 cut(s) 421
BssAI RCCGGY 1 cut(s) 563
BssECI CCNNGG 1 cut(s) 177
BssMI GATC 3 cut(s) 205, 240, 457
BssSI CACGAG 1 cut(s) 209
BssT1I CCWWGG 1 cut(s) 177
Bst2BI CACGAG 1 cut(s) 209
Bst4CI ACNGT 4 cut(s) 293, 425, 617, 691
BstAUI TGTACA 1 cut(s) 617
BstC8I GCNNGC 6 cut(s) 92, 158, 200, 338, 565, 611
BstDEI CTNAG 2 cut(s) 231, 363
BstF5I GGATG 2 cut(s) 537, 717
BstHHI GCGC 1 cut(s) 198
BstKTI GATC 3 cut(s) 208, 243, 460
BstMAI GTCTC 2 cut(s) 206, 459
BstMBI GATC 3 cut(s) 205, 240, 457
BstMWI GCNNNNNNNGC 3 cut(s) 71, 166, 657
BstNSI RCATGY 2 cut(s) 160, 554
BstV1I GCAGC 1 cut(s) 703
Bsu15I ATCGAT 1 cut(s) 283
BsuRI GGCC 1 cut(s) 176
BsuTUI ATCGAT 1 cut(s) 283
BtsCI GGATG 2 cut(s) 537, 717
BtsIMutI CAGTG 3 cut(s) 38, 414, 613
Cac8I GCNNGC 6 cut(s) 92, 158, 200, 338, 565, 611
CfoI GCGC 1 cut(s) 198
Cfr10I RCCGGY 1 cut(s) 563
ClaI ATCGAT 1 cut(s) 283
Csp6I GTAC 3 cut(s) 294, 618, 687
CviAII CATG 3 cut(s) 157, 455, 551
CviQI GTAC 3 cut(s) 294, 618, 687
DdeI CTNAG 2 cut(s) 231, 363
DpnI GATC 3 cut(s) 207, 242, 459
DpnII GATC 3 cut(s) 205, 240, 457
DriI GACNNNNNGTC 1 cut(s) 472
Eam1105I GACNNNNNGTC 1 cut(s) 472
Ecl136II GAGCTC 2 cut(s) 252, 369
Eco130I CCWWGG 1 cut(s) 177
Eco147I AGGCCT 1 cut(s) 176
Eco24I GRGCYC 3 cut(s) 254, 267, 371
Eco53kI GAGCTC 2 cut(s) 252, 369
EcoICRI GAGCTC 2 cut(s) 252, 369
EcoT14I CCWWGG 1 cut(s) 177
EcoT22I ATGCAT 1 cut(s) 456
EcoT38I GRGCYC 3 cut(s) 254, 267, 371
ErhI CCWWGG 1 cut(s) 177
FaeI CATG 3 cut(s) 160, 458, 554
FalI AAGNNNNNCTT 2 cut(s) 635, 667
FatI CATG 3 cut(s) 156, 454, 550
FauNDI CATATG 1 cut(s) 395
Fnu4HI GCNGC 1 cut(s) 717
FokI GGATG 1 cut(s) 544
FriOI GRGCYC 3 cut(s) 254, 267, 371
Fsp4HI GCNGC 1 cut(s) 717
FspBI CTAG 1 cut(s) 351
GlaI GCGC 1 cut(s) 197
GluI GCNGC 1 cut(s) 717
GsuI CTGGAG 1 cut(s) 191
HaeIII GGCC 1 cut(s) 176
HapII CCGG 1 cut(s) 564
HhaI GCGC 1 cut(s) 198
Hin1II CATG 3 cut(s) 160, 458, 554
Hin6I GCGC 1 cut(s) 196
HinP1I GCGC 1 cut(s) 196
HindIII AAGCTT 1 cut(s) 326
HinfI GANTC 3 cut(s) 140, 357, 437
HpaII CCGG 1 cut(s) 564
Hpy166II GTNNAC 2 cut(s) 356, 620
Hpy188III TCNNGA 2 cut(s) 209, 389
Hpy8I GTNNAC 2 cut(s) 356, 620
HpyAV CCTTC 1 cut(s) 702
HpyCH4III ACNGT 4 cut(s) 293, 425, 617, 691
HpyCH4V TGCA 9 cut(s) 106, 160, 288, 444, 454, 550, 594, 660, 719
HpyF10VI GCNNNNNNNGC 3 cut(s) 71, 166, 657
HpyF3I CTNAG 2 cut(s) 231, 363
Hsp92II CATG 3 cut(s) 160, 458, 554
HspAI GCGC 1 cut(s) 196
KroI GCCGGC 1 cut(s) 563
KroNI GCCGGC 1 cut(s) 565
Kzo9I GATC 3 cut(s) 205, 240, 457
LmnI GCTCC 1 cut(s) 249
LpnPI CCDG 9 cut(s) 92, 104, 155, 390, 402, 402, 462, 577, 591
Lsp1109I GCAGC 1 cut(s) 703
LweI GCATC 2 cut(s) 275, 637
MaeI CTAG 1 cut(s) 351
MaeIII GTNAC 3 cut(s) 35, 419, 583
MalI GATC 3 cut(s) 207, 242, 459
MboI GATC 3 cut(s) 205, 240, 457
MboII GAAGA 3 cut(s) 91, 122, 517
MhlI GDGCHC 4 cut(s) 254, 267, 371, 615
MluCI AATT 1 cut(s) 13
MlyI GAGTC 1 cut(s) 351
MnlI CCTC 4 cut(s) 166, 331, 495, 522
Mph1103I ATGCAT 1 cut(s) 456
MroNI GCCGGC 1 cut(s) 563
MslI CAYNNNNRTG 2 cut(s) 459, 549
MspA1I CMGCKG 1 cut(s) 169
MspI CCGG 1 cut(s) 564
MwoI GCNNNNNNNGC 3 cut(s) 71, 166, 657
NaeI GCCGGC 1 cut(s) 565
NdeI CATATG 1 cut(s) 395
NdeII GATC 3 cut(s) 205, 240, 457
NgoMIV GCCGGC 1 cut(s) 563
NlaIII CATG 3 cut(s) 160, 458, 554
NmuCI GTSAC 2 cut(s) 35, 583
NsiI ATGCAT 1 cut(s) 456
NspI RCATGY 2 cut(s) 160, 554
PaeI GCATGC 1 cut(s) 160
PceI AGGCCT 1 cut(s) 176
PdiI GCCGGC 1 cut(s) 565
PfeI GAWTC 2 cut(s) 140, 437
PkrI GCNGC 1 cut(s) 718
PleI GAGTC 1 cut(s) 351
PpsI GAGTC 1 cut(s) 351
Psp124BI GAGCTC 2 cut(s) 254, 371
PvuII CAGCTG 1 cut(s) 169
RsaI GTAC 3 cut(s) 295, 619, 688
RsaNI GTAC 3 cut(s) 294, 618, 687
RseI CAYNNNNRTG 2 cut(s) 459, 549
SacI GAGCTC 2 cut(s) 254, 371
SatI GCNGC 1 cut(s) 717
Sau3AI GATC 3 cut(s) 205, 240, 457
SchI GAGTC 1 cut(s) 351
SduI GDGCHC 4 cut(s) 254, 267, 371, 615
SetI ASST 8 cut(s) 96, 126, 171, 232, 254, 330, 342, 371
SfaNI GCATC 2 cut(s) 275, 637
SmiMI CAYNNNNRTG 2 cut(s) 459, 549
SmlI CTYRAG 2 cut(s) 225, 253
SmoI CTYRAG 2 cut(s) 225, 253
SphI GCATGC 1 cut(s) 160
Sse9I AATT 1 cut(s) 13
SseBI AGGCCT 1 cut(s) 176
SspI AATATT 1 cut(s) 102
SspMI CTAG 1 cut(s) 351
SstI GAGCTC 2 cut(s) 254, 371
StuI AGGCCT 1 cut(s) 176
StyI CCWWGG 1 cut(s) 177
TaaI ACNGT 4 cut(s) 293, 425, 617, 691
TaqI TCGA 1 cut(s) 283
TasI AATT 1 cut(s) 13
TatI WGTACW 2 cut(s) 293, 617
TfiI GAWTC 2 cut(s) 140, 437
TscAI CASTG 3 cut(s) 38, 421, 620
TseFI GTSAC 2 cut(s) 35, 583
TseI GCWGC 1 cut(s) 716
Tsp45I GTSAC 2 cut(s) 35, 583
TspDTI ATGAA 2 cut(s) 39, 546
TspRI CASTG 3 cut(s) 38, 421, 620
XapI RAATTY 1 cut(s) 13
XceI RCATGY 2 cut(s) 160, 554
XspI CTAG 1 cut(s) 351
Zsp2I ATGCAT 1 cut(s) 456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.