pycom01g00730

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000120
Physical Location & Seq
Forward (+)
728417 .. 731015
2599 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g00730.7

Sequence Viewer

Length: 2061 bp
ATGCTCATCATAGTAACGAATGCCTCTGTATCTTTATTGTGCTTTTCACAGTCCCTCCTAATCCCCGGTCCAGAACGATCCCTACTTACATACTTACTACAATTGATAAAAAGAGGGTTTAATTTGTGTGCGTATAATTCTCGCATCATAGATCTCCAGAAGGAAGATCAATTTCCGTTAAATAGAACATTCCAACCAACACTAGTTCCCAGATTTCCTTTTGATGTTGTACTCTTCATTTCGATGAGTATAGGCATGAGAGTACGAGTTGCTATACCTTCGGGTAGCAAAAATCCTAGAAGCAATAATCAATTTTTCCTAGAATCAACAAAACCAACTTATAGGACCGGTTCTTTACCAGTCATCCGAAACTATCCACCTAAGCGGGCTCTAACCTGTAATCAGCCTATGGTGGCATTACTGATTGACGATATTGTTCGATATCCAGGAATTGTCAACCAGTATTCGGGCGGTATAATTTCTGATACTGGACATAGGTACTATTTCAAGGTAATGAACAATATCAAGTTGTCATATATGCCTCGCGAATTTGTAGTAGTCTTACAGAGGACTTTCTCAACCATCCCAACAACGAGATTAAATTTTCTAAAACACCGACAGTCAGCTCATTACCAAATTCCTCAACTGTTAGCCTTGATTAAATTGGTACTTTTCTTGAGAGACGCGATCTTAGTAGACGATATTCTTTTCCTTTTCCCAAAAGGTTGTAGTGGAAGGAAGTTGAAATTCTCACAAAGTGTTGTGAAATTCGAGATATCTTTGATCTTAGTGTTTTTCCTTACTTATCAATCGAGGAAAGTTAGTTTAGTTGTGATGTTGATTATGACTAAAGTTTTTGACAACCGAATTGTTGTCTCACCTCACCTTTGTTTTACACCTTTCGATGACATTGATCATTTCGAAATCCATGATGACATGTTCTTTGGATGTTTCGGCTTTGTAGAGGCAAATCAACAGTTGTCATCTTCATTTGAAAACCGAATATCACTTCTCTGTGGAGAAATGTGTCCAAAATCTTCAGCAAACTCACAAACTTCTCAAATACACCTTCTATTGAAAAGTGCTAAATTTCTAACAGCGACGATGGAGATACCAAATCAACGTCTACAATTGCACTATCTAAAAGATGTATCTACCCTTGAAAACTTTCAACCTGTCCAATCCCAATTCCAGCTAGAATTCGTGAGTATTGATATGATATGGGGAAATATCACCATAAGCTCCCGGTCTGAGATATCCTATACATGTGGAGATTATGATGATGTTTCGTACTCATTCTTGAATTTATCGAATTTTTTGACGTTTCGATCAGTATTTACTCTGACTATGATTCCATATTCACCCCTCTGCTGGAAGGCATATGAGGAGTTCTATTCAACGCCTATGCAGCCACCACAACCTGCCCAAAGCAATATAGGTAATTCAAGTGATAATGATAAGATTTTTCAATTACTTACTACTTTGACGCAGGGAATCCAAACTCAAAACAAAGAGAGGAAAAATCAAGACAAAAGGTTGGACCACTTGGAAAAGCAAATTGGGCAGATAGCGGAGTTTGTAGGACAATTTTGCGACCAAGGCAAACTCCCTAGTTCAACCATTGTAAATCCGAAGGGAGTATTTGAAACCACCAATGCTATCATGTTAAGAAGTGGCAAGGAGGTTGGAACGGACCCTCAACCATCAAATTCAAATCACAAGGAAGATGAAAGATTGCAATTTGAGGAAGTGGAGTTGGACAAAGCCACGGAAAGGGTGGAAACACCTTTGCCACAGCCACCTCAAGACCCTAATTCATCCACCATAGGTAAGCCCTATTCCTTGCAGGTTCATAAATTCCAAGTGTCACGGGCCATATGTTACAAACAAAGAAAACGCCCAAGACATCATATATCTAAGCCCATAAAGCCTTGTCTTCATAGAAGCTTCCGGAACATCCCGGAAAAATCAAGAACATGGCGGAGCGTTCAAGATAATCTAGGGCATTCCGGAACAATCCACACAAGTGTACAAATTCAAGCCTCACCTAGAACAATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotrans_gag

Protein Analysis

687

Amino Acids

78.55

Weight (kDa)

9.25

Isoelectric Point (pI)

46.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 1429, 1837
AccI GTMKAC 2 cut(s) 696, 1126
AccII CGCG 2 cut(s) 546, 686
AccIII TCCGGA 2 cut(s) 1950, 2009
AciI CCGC 4 cut(s) 385, 471, 1571, 1981
AclWI GGATC 1 cut(s) 72
AcuI CTGAAG 1 cut(s) 1023
AdeI CACNNNGTG 1 cut(s) 758
AfaI GTAC 6 cut(s) 231, 264, 500, 669, 1292, 2031
AfiI CCNNNNNNNGG 3 cut(s) 466, 1371, 1773
AflIII ACRYGT 2 cut(s) 936, 1265
AgeI ACCGGT 1 cut(s) 347
AhlI ACTAGT 1 cut(s) 202
AjnI CCWGG 1 cut(s) 445
AjuI GAANNNNNNNTTGG 2 cut(s) 1542, 1574
AleI CACNNNNGTG 1 cut(s) 2025
AluBI AGCT 4 cut(s) 626, 1195, 1242, 1947
AluI AGCT 4 cut(s) 626, 1195, 1242, 1947
Alw26I GTCTC 2 cut(s) 675, 880
AlwI GGATC 1 cut(s) 72
Aor13HI TCCGGA 2 cut(s) 1950, 2009
AoxI GGCC 1 cut(s) 1872
ApeKI GCWGC 1 cut(s) 1408
ArsI GACNNNNNNTTYG 2 cut(s) 926, 958
AsiGI ACCGGT 1 cut(s) 347
Asp700I GAANNNNTTC 1 cut(s) 1167
AspS9I GGNCC 5 cut(s) 68, 345, 1540, 1693, 1872
AsuC2I CCSGG 3 cut(s) 66, 1246, 1961
AsuHPI GGTGA 5 cut(s) 870, 875, 1225, 1353, 2037
AsuII TTCGAA 1 cut(s) 921
AvaII GGWCC 4 cut(s) 68, 345, 1540, 1693
BanII GRGCYC 1 cut(s) 391
BbsI GAAGAC 1 cut(s) 1928
BbvI GCAGC 1 cut(s) 1420
BccI CCATC 3 cut(s) 590, 1099, 1711
BciT130I CCWGG 1 cut(s) 447
BclI TGATCA 1 cut(s) 913
BcnI CCSGG 3 cut(s) 66, 1246, 1961
BcoDI GTCTC 2 cut(s) 675, 880
BcuI ACTAGT 1 cut(s) 202
BfaI CTAG 8 cut(s) 203, 297, 320, 1196, 1611, 2000, 2049, 2059
BfuAI ACCTGC 2 cut(s) 1429, 1837
BglII AGATCT 1 cut(s) 151
BisI GCNGC 1 cut(s) 1409
BlsI GCNGC 1 cut(s) 1410
Bme1390I CCNGG 4 cut(s) 66, 447, 1246, 1961
Bme18I GGWCC 4 cut(s) 68, 345, 1540, 1693
BmgT120I GGNCC 5 cut(s) 68, 345, 1540, 1693, 1872
BmiI GGNNCC 1 cut(s) 1695
BmrFI CCNGG 4 cut(s) 66, 447, 1246, 1961
BmsI GCATC 1 cut(s) 153
BpiI GAAGAC 1 cut(s) 1928
BpmI CTGGAG 1 cut(s) 140
Bpu10I CCTNAGC 1 cut(s) 381
Bpu14I TTCGAA 1 cut(s) 921
BpuEI CTTGAG 2 cut(s) 697, 1788
BpuMI CCSGG 3 cut(s) 66, 1246, 1961
BsaJI CCNNGG 3 cut(s) 64, 1597, 1767
BsaWI WCCGGW 3 cut(s) 347, 1950, 2009
BsaXI ACNNNNNCTCC 2 cut(s) 39, 69
Bsc4I CCNNNNNNNGG 3 cut(s) 466, 1371, 1773
Bse118I RCCGGY 1 cut(s) 347
Bse1I ACTGG 3 cut(s) 359, 460, 493
BseAI TCCGGA 2 cut(s) 1950, 2009
BseBI CCWGG 1 cut(s) 447
BseDI CCNNGG 3 cut(s) 64, 1597, 1767
BseGI GGATG 5 cut(s) 363, 582, 953, 1817, 1956
BseLI CCNNNNNNNGG 3 cut(s) 466, 1371, 1773
BseMII CTCAG 1 cut(s) 1242
BseNI ACTGG 3 cut(s) 359, 460, 493
BseRI GAGGAG 1 cut(s) 1400
BseXI GCAGC 1 cut(s) 1420
Bsh1236I CGCG 2 cut(s) 546, 686
BshFI GGCC 1 cut(s) 1874
BshTI ACCGGT 1 cut(s) 347
BsiSI CCGG 6 cut(s) 66, 348, 1246, 1951, 1961, 2010
BslFI GGGAC 1 cut(s) 37
BslI CCNNNNNNNGG 3 cut(s) 466, 1371, 1773
BsmAI GTCTC 2 cut(s) 675, 880
BsmBI CGTCTC 1 cut(s) 675
BsmFI GGGAC 1 cut(s) 37
BsmI GAATGC 2 cut(s) 25, 2005
BsnI GGCC 1 cut(s) 1874
Bsp119I TTCGAA 1 cut(s) 921
Bsp1286I GDGCHC 1 cut(s) 391
Bsp13I TCCGGA 2 cut(s) 1950, 2009
Bsp1407I TGTACA 1 cut(s) 2029
Bsp143I GATC 7 cut(s) 77, 151, 166, 687, 783, 913, 1328
Bsp68I TCGCGA 1 cut(s) 546
BspACI CCGC 4 cut(s) 385, 471, 1571, 1981
BspANI GGCC 1 cut(s) 1874
BspCNI CTCAG 1 cut(s) 1243
BspEI TCCGGA 2 cut(s) 1950, 2009
BspFNI CGCG 2 cut(s) 546, 686
BspLI GGNNCC 1 cut(s) 1695
BspMI ACCTGC 2 cut(s) 1429, 1837
BspPI GGATC 1 cut(s) 72
BspT104I TTCGAA 1 cut(s) 921
BsrFI RCCGGY 1 cut(s) 347
BsrGI TGTACA 1 cut(s) 2029
BsrI ACTGG 3 cut(s) 359, 460, 493
BssAI RCCGGY 1 cut(s) 347
BssECI CCNNGG 3 cut(s) 64, 1597, 1767
BssMI GATC 7 cut(s) 77, 151, 166, 687, 783, 913, 1328
BssT1I CCWWGG 1 cut(s) 1597
Bst2UI CCWGG 1 cut(s) 447
Bst4CI ACNGT 4 cut(s) 51, 621, 648, 978
Bst6I CTCTTC 1 cut(s) 239
BstAUI TGTACA 1 cut(s) 2029
BstBI TTCGAA 1 cut(s) 921
BstC8I GCNNGC 1 cut(s) 387
BstDEI CTNAG 5 cut(s) 381, 691, 787, 1251, 1917
BstDSI CCRYGG 1 cut(s) 1767
BstF5I GGATG 5 cut(s) 363, 582, 953, 1817, 1956
BstFNI CGCG 2 cut(s) 546, 686
BstKTI GATC 7 cut(s) 80, 154, 169, 690, 786, 916, 1331
BstMAI GTCTC 2 cut(s) 675, 880
BstMBI GATC 7 cut(s) 77, 151, 166, 687, 783, 913, 1328
BstMWI GCNNNNNNNGC 4 cut(s) 1408, 1561, 1599, 1927
BstNI CCWGG 1 cut(s) 447
BstNSI RCATGY 2 cut(s) 940, 1269
BstSCI CCNGG 4 cut(s) 64, 445, 1244, 1959
BstUI CGCG 2 cut(s) 546, 686
BstV1I GCAGC 1 cut(s) 1420
BstV2I GAAGAC 1 cut(s) 1928
BstX2I RGATCY 1 cut(s) 151
BstYI RGATCY 1 cut(s) 151
BsuRI GGCC 1 cut(s) 1874
BtgI CCRYGG 1 cut(s) 1767
BtsCI GGATG 5 cut(s) 363, 582, 953, 1817, 1956
BtuMI TCGCGA 1 cut(s) 546
BveI ACCTGC 2 cut(s) 1429, 1837
Cac8I GCNNGC 1 cut(s) 387
Cfr10I RCCGGY 1 cut(s) 347
Cfr13I GGNCC 5 cut(s) 68, 345, 1540, 1693, 1872
CseI GACGC 2 cut(s) 692, 1495
Csp6I GTAC 6 cut(s) 230, 263, 499, 668, 1291, 2030
CspAI ACCGGT 1 cut(s) 347
CviAII CATG 6 cut(s) 256, 929, 937, 1266, 1663, 1977
CviQI GTAC 6 cut(s) 230, 263, 499, 668, 1291, 2030
DdeI CTNAG 5 cut(s) 381, 691, 787, 1251, 1917
DpnI GATC 7 cut(s) 79, 153, 168, 689, 785, 915, 1330
DpnII GATC 7 cut(s) 77, 151, 166, 687, 783, 913, 1328
DraIII CACNNNGTG 1 cut(s) 758
Eam1104I CTCTTC 1 cut(s) 239
EarI CTCTTC 1 cut(s) 239
EciI GGCGGA 1 cut(s) 1996
Eco130I CCWWGG 1 cut(s) 1597
Eco24I GRGCYC 1 cut(s) 391
Eco32I GATATC 3 cut(s) 443, 777, 1257
Eco47I GGWCC 4 cut(s) 68, 345, 1540, 1693
Eco57I CTGAAG 1 cut(s) 1023
EcoRI GAATTC 1 cut(s) 1199
EcoRII CCWGG 1 cut(s) 445
EcoRV GATATC 3 cut(s) 443, 777, 1257
EcoT14I CCWWGG 1 cut(s) 1597
EcoT38I GRGCYC 1 cut(s) 391
ErhI CCWWGG 1 cut(s) 1597
Esp3I CGTCTC 1 cut(s) 675
FaeI CATG 6 cut(s) 259, 932, 940, 1269, 1666, 1980
FaqI GGGAC 1 cut(s) 37
FatI CATG 6 cut(s) 255, 928, 936, 1265, 1662, 1976
FauI CCCGC 1 cut(s) 378
FauNDI CATATG 2 cut(s) 1381, 1877
FbaI TGATCA 1 cut(s) 913
FblI GTMKAC 2 cut(s) 696, 1126
Fnu4HI GCNGC 1 cut(s) 1409
FokI GGATG 5 cut(s) 350, 569, 960, 1804, 1943
FriOI GRGCYC 1 cut(s) 391
Fsp4HI GCNGC 1 cut(s) 1409
FspBI CTAG 8 cut(s) 203, 297, 320, 1196, 1611, 2000, 2049, 2059
GluI GCNGC 1 cut(s) 1409
GsuI CTGGAG 1 cut(s) 140
HaeIII GGCC 1 cut(s) 1874
HapII CCGG 6 cut(s) 66, 348, 1246, 1951, 1961, 2010
HgaI GACGC 2 cut(s) 692, 1495
Hin1II CATG 6 cut(s) 259, 932, 940, 1269, 1666, 1980
HincII GTYRAC 1 cut(s) 457
HindII GTYRAC 1 cut(s) 457
HindIII AAGCTT 1 cut(s) 1945
HinfI GANTC 3 cut(s) 323, 1351, 1494
HpaII CCGG 6 cut(s) 66, 348, 1246, 1951, 1961, 2010
HphI GGTGA 5 cut(s) 870, 875, 1225, 1353, 2037
Hpy166II GTNNAC 4 cut(s) 457, 697, 1127, 2030
Hpy188I TCNGA 5 cut(s) 368, 484, 1252, 1344, 1632
Hpy8I GTNNAC 4 cut(s) 457, 697, 1127, 2030
Hpy99I CGWCG 1 cut(s) 1105
HpyAV CCTTC 6 cut(s) 154, 288, 729, 1079, 1369, 1627
HpyCH4III ACNGT 4 cut(s) 51, 621, 648, 978
HpyCH4IV ACGT 2 cut(s) 1123, 1322
HpyCH4V TGCA 4 cut(s) 1135, 1408, 1738, 1846
HpyF10VI GCNNNNNNNGC 4 cut(s) 1408, 1561, 1599, 1927
HpyF3I CTNAG 5 cut(s) 381, 691, 787, 1251, 1917
HpySE526I ACGT 2 cut(s) 1123, 1322
Hsp92II CATG 6 cut(s) 259, 932, 940, 1269, 1666, 1980
Kpn2I TCCGGA 2 cut(s) 1950, 2009
Ksp22I TGATCA 1 cut(s) 913
Kzo9I GATC 7 cut(s) 77, 151, 166, 687, 783, 913, 1328
LmnI GCTCC 2 cut(s) 1247, 1983
Lsp1109I GCAGC 1 cut(s) 1420
LweI GCATC 1 cut(s) 153
MaeI CTAG 8 cut(s) 203, 297, 320, 1196, 1611, 2000, 2049, 2059
MaeII ACGT 2 cut(s) 1123, 1322
MaeIII GTNAC 3 cut(s) 13, 1866, 1880
MalI GATC 7 cut(s) 79, 153, 168, 689, 785, 915, 1330
MboI GATC 7 cut(s) 77, 151, 166, 687, 783, 913, 1328
MboII GAAGA 6 cut(s) 176, 226, 978, 1029, 1736, 1928
MfeI CAATTG 2 cut(s) 101, 1130
MflI RGATCY 1 cut(s) 151
MhlI GDGCHC 1 cut(s) 391
MmeI TCCRAC 4 cut(s) 217, 1518, 1666, 1737
MroI TCCGGA 2 cut(s) 1950, 2009
MroXI GAANNNNTTC 1 cut(s) 1167
MseI TTAA 5 cut(s) 120, 179, 599, 660, 1667
MslI CAYNNNNRTG 2 cut(s) 242, 2025
MspI CCGG 6 cut(s) 66, 348, 1246, 1951, 1961, 2010
MspR9I CCNGG 4 cut(s) 66, 447, 1246, 1961
MunI CAATTG 2 cut(s) 101, 1130
Mva1269I GAATGC 2 cut(s) 25, 2005
MvaI CCWGG 1 cut(s) 447
MvnI CGCG 2 cut(s) 546, 686
MwoI GCNNNNNNNGC 4 cut(s) 1408, 1561, 1599, 1927
NciI CCSGG 3 cut(s) 66, 1246, 1961
NdeI CATATG 2 cut(s) 1381, 1877
NdeII GATC 7 cut(s) 77, 151, 166, 687, 783, 913, 1328
NlaIII CATG 6 cut(s) 259, 932, 940, 1269, 1666, 1980
NlaIV GGNNCC 1 cut(s) 1695
NmuCI GTSAC 1 cut(s) 1866
NruI TCGCGA 1 cut(s) 546
NspI RCATGY 2 cut(s) 940, 1269
NspV TTCGAA 1 cut(s) 921
OliI CACNNNNGTG 1 cut(s) 2025
PciI ACATGT 2 cut(s) 936, 1265
PctI GAATGC 2 cut(s) 25, 2005
PdmI GAANNNNTTC 1 cut(s) 1167
PfeI GAWTC 3 cut(s) 323, 1351, 1494
PfoI TCCNGGA 2 cut(s) 445, 1959
PinAI ACCGGT 1 cut(s) 347
PkrI GCNGC 1 cut(s) 1410
PscI ACATGT 2 cut(s) 936, 1265
Psp6I CCWGG 1 cut(s) 445
PspGI CCWGG 1 cut(s) 445
PspN4I GGNNCC 1 cut(s) 1695
PspPI GGNCC 5 cut(s) 68, 345, 1540, 1693, 1872
PsrI GAACNNNNNNTAC 2 cut(s) 66, 98
PsuI RGATCY 1 cut(s) 151
RruI TCGCGA 1 cut(s) 546
RsaI GTAC 6 cut(s) 231, 264, 500, 669, 1292, 2031
RsaNI GTAC 6 cut(s) 230, 263, 499, 668, 1291, 2030
RseI CAYNNNNRTG 2 cut(s) 242, 2025
SaqAI TTAA 5 cut(s) 120, 179, 599, 660, 1667
SatI GCNGC 1 cut(s) 1409
Sau3AI GATC 7 cut(s) 77, 151, 166, 687, 783, 913, 1328
Sau96I GGNCC 5 cut(s) 68, 345, 1540, 1693, 1872
ScrFI CCNGG 4 cut(s) 66, 447, 1246, 1961
SduI GDGCHC 1 cut(s) 391
SfaNI GCATC 1 cut(s) 153
SfuI TTCGAA 1 cut(s) 921
SinI GGWCC 4 cut(s) 68, 345, 1540, 1693
SmiMI CAYNNNNRTG 2 cut(s) 242, 2025
SmlI CTYRAG 2 cut(s) 676, 1803
SmoI CTYRAG 2 cut(s) 676, 1803
SpeI ACTAGT 1 cut(s) 202
SsiI CCGC 4 cut(s) 385, 471, 1571, 1981
SspMI CTAG 8 cut(s) 203, 297, 320, 1196, 1611, 2000, 2049, 2059
StyD4I CCNGG 4 cut(s) 64, 445, 1244, 1959
StyI CCWWGG 1 cut(s) 1597
TaaI ACNGT 4 cut(s) 51, 621, 648, 978
TaiI ACGT 2 cut(s) 1126, 1325
TaqI TCGA 8 cut(s) 242, 439, 771, 812, 903, 921, 1310, 1327
TatI WGTACW 2 cut(s) 229, 2029
TfiI GAWTC 3 cut(s) 323, 1351, 1494
Tru1I TTAA 5 cut(s) 120, 179, 599, 660, 1667
Tru9I TTAA 5 cut(s) 120, 179, 599, 660, 1667
TseFI GTSAC 1 cut(s) 1866
TseI GCWGC 1 cut(s) 1408
Tsp45I GTSAC 1 cut(s) 1866
TspDTI ATGAA 7 cut(s) 226, 530, 978, 1743, 1806, 1841, 1928
TspGWI ACGGA 3 cut(s) 165, 1706, 1784
VpaK11BI GGWCC 4 cut(s) 68, 345, 1540, 1693
XceI RCATGY 2 cut(s) 940, 1269
XcmI CCANNNNNNNNNTGG 1 cut(s) 1774
XmiI GTMKAC 2 cut(s) 696, 1126
XmnI GAANNNNTTC 1 cut(s) 1167
XspI CTAG 8 cut(s) 203, 297, 320, 1196, 1611, 2000, 2049, 2059
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.