Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr1

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

8788071 .. 8791641

Gene Structure 3571 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom01g07800.5

Sequence Viewer

CDS Protein Promoter (2k)

Length: 387 bp

ATGCTGACACGGGTAAATGTATGGTGCCCTTCTTTCTTATCTTCTAATGGCCCTTTGACAGGTGAAGATTCTGTGATGAAGGACGCAACAACAGCTACGATAGTAGCTAGGAACCTCCTCACTCCTAAGGATAGTAGGCTGCTTTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTCAGTGTTCAGTGTGCAGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGATCCCGTCAAGTGGAATCATTGATGGCGGAGGTGGAAACTCTTAAGCAAGAGATCAAACAGCTTAAGCACGAGAATAGAACTTTTGGTTTTGTCAAACGATCTTACAGAGGCATTCCTTGCAATCTTTATAGCAAGGAGTCTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000160 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0007154 GO:0007165 GO:0008150 GO:0009719 GO:0009723 GO:0009725 GO:0009755 GO:0009787 GO:0009789 GO:0009873 GO:0009889 GO:0009891 GO:0009893 GO:0009966 GO:0009967 GO:0009987 GO:0010033 GO:0010118 GO:0010185 GO:0010186 GO:0010200 GO:0010243 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010628 GO:0010646 GO:0010647 GO:0019219 GO:0019222 GO:0023051 GO:0023052 GO:0023056 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0031347 GO:0031349 GO:0032870 GO:0035556 GO:0042221 GO:0042493 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044424 GO:0044464 GO:0045893 GO:0045935 GO:0048518 GO:0048522 GO:0048583 GO:0048584 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051173 GO:0051252 GO:0051254 GO:0051716 GO:0060255 GO:0065007 GO:0070887 GO:0071310 GO:0071369 GO:0071495 GO:0080090 GO:0080134 GO:0090332 GO:0097159 GO:0140110 GO:1901363 GO:1901419 GO:1901421 GO:1901698 GO:1901700 GO:1902680 GO:1903506 GO:1903508 GO:1905957 GO:1905959 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AP2

Protein Analysis

129

Amino Acids

14.18

Weight (kDa)

9.18

Isoelectric Point (pI)

41.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	24
AciI	CCGC	1 cut(s)	269
AclWI	GGATC	1 cut(s)	237
AcoI	YGGCCR	1 cut(s)	165
AfiI	CCNNNNNNNGG	2 cut(s)	59, 253
AflII	CTTAAG	2 cut(s)	284, 305
AgsI	TTSAA	1 cut(s)	173
AluBI	AGCT	3 cut(s)	95, 107, 304
AluI	AGCT	3 cut(s)	95, 107, 304
AlwI	GGATC	1 cut(s)	237
AlwNI	CAGNNNCTG	1 cut(s)	209
AoxI	GGCC	3 cut(s)	49, 165, 223
ApeKI	GCWGC	1 cut(s)	139
AspS9I	GGNCC	3 cut(s)	50, 153, 223
AsuHPI	GGTGA	1 cut(s)	74
AvaII	GGWCC	1 cut(s)	153
AxyI	CCTNAGG	1 cut(s)	126
BaeGI	GKGCMC	1 cut(s)	29
BanI	GGYRCC	1 cut(s)	24
BauI	CACGAG	1 cut(s)	311
BbvI	GCAGC	1 cut(s)	126
BccI	CCATC	1 cut(s)	259
BceAI	ACGGC	1 cut(s)	152
BfaI	CTAG	1 cut(s)	108
BfrI	CTTAAG	2 cut(s)	284, 305
BisI	GCNGC	1 cut(s)	140
BlsI	GCNGC	1 cut(s)	141
Bme18I	GGWCC	1 cut(s)	153
BmgT120I	GGNCC	3 cut(s)	50, 153, 223
BmiI	GGNNCC	2 cut(s)	26, 113
Bsc4I	CCNNNNNNNGG	2 cut(s)	59, 253
Bse21I	CCTNAGG	1 cut(s)	126
BseLI	CCNNNNNNNGG	2 cut(s)	59, 253
BseMII	CTCAG	1 cut(s)	202
BseRI	GAGGAG	1 cut(s)	107
BseSI	GKGCMC	1 cut(s)	29
BseXI	GCAGC	1 cut(s)	126
BsgI	GTGCAG	1 cut(s)	222
BshFI	GGCC	3 cut(s)	51, 167, 225
BshNI	GGYRCC	1 cut(s)	24
BslFI	GGGAC	1 cut(s)	163
BslI	CCNNNNNNNGG	2 cut(s)	59, 253
BsmFI	GGGAC	1 cut(s)	163
BsmI	GAATGC	1 cut(s)	354
BsnI	GGCC	3 cut(s)	51, 167, 225
Bsp1286I	GDGCHC	1 cut(s)	29
Bsp143I	GATC	3 cut(s)	242, 294, 341
BspACI	CCGC	1 cut(s)	269
BspANI	GGCC	3 cut(s)	51, 167, 225
BspCNI	CTCAG	1 cut(s)	201
BspLI	GGNNCC	2 cut(s)	26, 113
BspPI	GGATC	1 cut(s)	237
BspT107I	GGYRCC	1 cut(s)	24
BspTI	CTTAAG	2 cut(s)	284, 305
BssMI	GATC	3 cut(s)	242, 294, 341
BssSI	CACGAG	1 cut(s)	311
Bst2BI	CACGAG	1 cut(s)	311
Bst4CI	ACNGT	1 cut(s)	153
BstAFI	CTTAAG	2 cut(s)	284, 305
BstAPI	GCANNNNNTGC	1 cut(s)	360
BstC8I	GCNNGC	1 cut(s)	205
BstDEI	CTNAG	2 cut(s)	126, 188
BstENI	CCTNNNNNAGG	1 cut(s)	57
BstKTI	GATC	3 cut(s)	245, 297, 344
BstMBI	GATC	3 cut(s)	242, 294, 341
BstMWI	GCNNNNNNNGC	2 cut(s)	92, 360
BstSLI	GKGCMC	1 cut(s)	29
BstV1I	GCAGC	1 cut(s)	126
Bsu36I	CCTNAGG	1 cut(s)	126
BsuRI	GGCC	3 cut(s)	51, 167, 225
BtsIMutI	CAGTG	2 cut(s)	196, 203
Cac8I	GCNNGC	1 cut(s)	205
CaiI	CAGNNNCTG	1 cut(s)	209
Cfr13I	GGNCC	3 cut(s)	50, 153, 223
CpoI	CGGWCCG	1 cut(s)	153
CseI	GACGC	1 cut(s)	92
CspI	CGGWCCG	1 cut(s)	153
CviAII	CATG	1 cut(s)	220
CviJI	RGCY	8 cut(s)	51, 95, 107, 139, 167, 207, 225, 304
CviKI_1	RGCY	8 cut(s)	51, 95, 107, 139, 167, 207, 225, 304
DdeI	CTNAG	2 cut(s)	126, 188
DpnI	GATC	3 cut(s)	244, 296, 343
DpnII	GATC	3 cut(s)	242, 294, 341
EaeI	YGGCCR	1 cut(s)	165
EciI	GGCGGA	1 cut(s)	284
Eco47I	GGWCC	1 cut(s)	153
Eco81I	CCTNAGG	1 cut(s)	126
EcoNI	CCTNNNNNAGG	1 cut(s)	57
FaeI	CATG	1 cut(s)	223
FaiI	YATR	3 cut(s)	22, 221, 372
FaqI	GGGAC	1 cut(s)	163
FatI	CATG	1 cut(s)	219
Fnu4HI	GCNGC	1 cut(s)	140
Fsp4HI	GCNGC	1 cut(s)	140
FspBI	CTAG	1 cut(s)	108
GluI	GCNGC	1 cut(s)	140
HaeIII	GGCC	3 cut(s)	51, 167, 225
HgaI	GACGC	1 cut(s)	92
Hin1II	CATG	1 cut(s)	223
HinfI	GANTC	4 cut(s)	68, 176, 257, 380
HphI	GGTGA	1 cut(s)	74
Hpy188I	TCNGA	1 cut(s)	157
Hpy188III	TCNNGA	3 cut(s)	147, 173, 384
HpyAV	CCTTC	2 cut(s)	39, 73
HpyCH4III	ACNGT	1 cut(s)	153
HpyCH4V	TGCA	2 cut(s)	203, 363
HpyF10VI	GCNNNNNNNGC	2 cut(s)	92, 360
HpyF3I	CTNAG	2 cut(s)	126, 188
Hsp92II	CATG	1 cut(s)	223
Kzo9I	GATC	3 cut(s)	242, 294, 341
LpnPI	CCDG	3 cut(s)	45, 132, 189
Lsp1109I	GCAGC	1 cut(s)	126
MaeI	CTAG	1 cut(s)	108
MalI	GATC	3 cut(s)	244, 296, 343
MboI	GATC	3 cut(s)	242, 294, 341
MboII	GAAGA	2 cut(s)	33, 77
MhlI	GDGCHC	1 cut(s)	29
MlyI	GAGTC	1 cut(s)	185
MmeI	TCCRAC	1 cut(s)	240
MnlI	CCTC	5 cut(s)	125, 128, 191, 265, 344
MseI	TTAA	2 cut(s)	285, 306
MspCI	CTTAAG	2 cut(s)	284, 305
Mva1269I	GAATGC	1 cut(s)	354
MwoI	GCNNNNNNNGC	2 cut(s)	92, 360
NdeII	GATC	3 cut(s)	242, 294, 341
NlaIII	CATG	1 cut(s)	223
NlaIV	GGNNCC	2 cut(s)	26, 113
PctI	GAATGC	1 cut(s)	354
PfeI	GAWTC	2 cut(s)	68, 257
PkrI	GCNGC	1 cut(s)	141
PleI	GAGTC	1 cut(s)	184
PpsI	GAGTC	1 cut(s)	184
PspN4I	GGNNCC	2 cut(s)	26, 113
PspPI	GGNCC	3 cut(s)	50, 153, 223
PstNI	CAGNNNCTG	1 cut(s)	209
Rsr2I	CGGWCCG	1 cut(s)	153
RsrII	CGGWCCG	1 cut(s)	153
SaqAI	TTAA	2 cut(s)	285, 306
SatI	GCNGC	1 cut(s)	140
Sau3AI	GATC	3 cut(s)	242, 294, 341
Sau96I	GGNCC	3 cut(s)	50, 153, 223
SchI	GAGTC	1 cut(s)	185
SduI	GDGCHC	1 cut(s)	29
SetI	ASST	6 cut(s)	64, 97, 109, 117, 276, 306
SinI	GGWCC	1 cut(s)	153
SmlI	CTYRAG	2 cut(s)	284, 305
SmoI	CTYRAG	2 cut(s)	284, 305
SsiI	CCGC	1 cut(s)	269
SspMI	CTAG	1 cut(s)	108
TaaI	ACNGT	1 cut(s)	153
TaqI	TCGA	1 cut(s)	241
TfiI	GAWTC	2 cut(s)	68, 257
Tru1I	TTAA	2 cut(s)	285, 306
Tru9I	TTAA	2 cut(s)	285, 306
TscAI	CASTG	2 cut(s)	196, 203
TseI	GCWGC	1 cut(s)	139
TspDTI	ATGAA	1 cut(s)	92
TspRI	CASTG	2 cut(s)	196, 203
Vha464I	CTTAAG	2 cut(s)	284, 305
VpaK11BI	GGWCC	1 cut(s)	153
XagI	CCTNNNNNAGG	1 cut(s)	57
XspI	CTAG	1 cut(s)	108

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.