pycom1256g00180

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001256
OG0000120
Physical Location & Seq
Forward (+)
133213 .. 135162
1950 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom1256g00180.3

Sequence Viewer

Length: 1365 bp
ATGCTTCTAGAAATAGGTTCTAGAATTATCTATTTAGGTCCCCTTGCAATTAGGATTAAGACATGGTTTTGGATAGGGTTTCCTCTTTTGAGCTACTTCCTTATCCACTTTGTCTTTAGCTTAGTTCCTTCCTCTTCTTATCATATTTCTAATGCAAGCTATCCACATAGTGTCCAAAATAGCTCCAAAATGCATTTTCTTGATACTTTAACCCATAGGACCTACAAACACACTGATAGGAGTTTTGTTTCCTTAGTTATTTTAGTGTTTAAAGTCACTTTTGTGTATTTTCAGATTATAAGGCCAAAGTGTGCAAGAAGATGCAAATTGGAGTCTTTTGGATCCTACTCCACCGATGAATTCCTACCAAAACGAGGATTCCTACTCAAACAAGGATTCCTACTTGAAATAGGAAAGTTAACCCTAGGTTTCCCCCACTTTGAAGGCCTTGTATGCACTTTAGGACACAAAAACAAGGCCCTAGCCCAATTACATAACCTTGCCGTGGGTTTTTCCCTTCTCCCCTTCCCTTGCCGTGCAAGGGAGGGCATTTTTGTTCTGATTTTATTTCCTAATTCTATAATTCTGAAAACCCTAGGGTCTCCACCATTTAGCCGCACCCTAGGGGGGGTTTTGGTGGATTTCTTTTCAGCCGTTCATCATCATTCATCATTCCATCTCAGCCTGAATATTCATTCAGCCATCATCATTGACATATTCCCCCTAAGCCGCGACCATTCACTAAATTCTCTCCCTAAGCCGTCACTCCCATCAGCCACAAAACCTAACAGCCGCAGCCACCCATTGATCTTCTCCATTCAATCTGTGCATTCCCCTTCCATTCCAGCCACACCCCACCATTGCCGCAGCACTACCAACCCTTCCAGCCACCTTCCACACCTCCATACACCTTCTTACCACCTTGCCGCACCACCACACTTCCCTAAACCCATTCTCAAACCAGAAAATCATCCAAAAACCACCCACATCATCTCTACCGCAGCAAGGAGAATAAGAAAGAGGAGCTTAGACGCGCAGAAATTCAAGTGGATTTTTCAATTTTGTTTCTCTTTCTGTGAACATGAGAGGCTAAACCCCCTAAAGTTGATTAGTTCCAGTTATCGTTGCATAAGTCTTGAATACAATTTTGAGAGTGCACGCTTAATTTGCATGCTTGAATTTGATATTCCTGGCAAGCGTATCATGTTTTTCATAGTTACAAATGCCTTGTCGATGCTTATGATTTCCAAAGAACGTAATGATTCTAACTTATGTCTTTATCATGCTGTTCATATAGAGAATTTGTTAGGAATAATTTGTTTGCGATGCATATTCATCCAATTCAATGATTCTAGGGAAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

455

Amino Acids

51.85

Weight (kDa)

9.72

Isoelectric Point (pI)

46.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 299
AccII CGCG 2 cut(s) 732, 1034
AciI CCGC 6 cut(s) 616, 730, 793, 865, 927, 999
AclWI GGATC 2 cut(s) 336, 349
AcsI RAATTY 5 cut(s) 359, 745, 1040, 1178, 1300
AdeI CACNNNGTG 1 cut(s) 170
AfiI CCNNNNNNNGG 6 cut(s) 374, 505, 541, 627, 628, 1005
AgsI TTSAA 8 cut(s) 407, 443, 821, 1045, 1058, 1139, 1178, 1345
AjnI CCWGG 1 cut(s) 1189
AleI CACNNNNGTG 1 cut(s) 281
AluBI AGCT 5 cut(s) 93, 120, 159, 183, 1026
AluI AGCT 5 cut(s) 93, 120, 159, 183, 1026
Alw21I GWGCWC 1 cut(s) 1159
Alw26I GTCTC 1 cut(s) 606
Alw44I GTGCAC 1 cut(s) 1155
AlwI GGATC 2 cut(s) 336, 349
AoxI GGCC 3 cut(s) 302, 445, 477
ApaLI GTGCAC 1 cut(s) 1155
ApeKI GCWGC 3 cut(s) 795, 867, 1001
ApoI RAATTY 5 cut(s) 359, 745, 1040, 1178, 1300
ArsI GACNNNNNNTTYG 2 cut(s) 1214, 1246
AspA2I CCTAGG 3 cut(s) 424, 595, 622
AspLEI GCGC 1 cut(s) 1036
AspS9I GGNCC 3 cut(s) 38, 219, 478
AvaII GGWCC 2 cut(s) 38, 219
AvrII CCTAGG 3 cut(s) 424, 595, 622
BaeGI GKGCMC 1 cut(s) 1159
BamHI GGATCC 1 cut(s) 341
Bbv12I GWGCWC 1 cut(s) 1159
BbvI GCAGC 3 cut(s) 807, 879, 1013
BccI CCATC 3 cut(s) 684, 710, 778
BceAI ACGGC 4 cut(s) 488, 519, 638, 745
BciT130I CCWGG 1 cut(s) 1191
BcoDI GTCTC 1 cut(s) 606
BfaI CTAG 7 cut(s) 8, 21, 425, 482, 596, 623, 1353
BisI GCNGC 8 cut(s) 616, 730, 793, 796, 865, 868, 927, 1002
BlnI CCTAGG 3 cut(s) 424, 595, 622
BlsI GCNGC 8 cut(s) 617, 731, 794, 797, 866, 869, 928, 1003
Bme1390I CCNGG 1 cut(s) 1191
Bme18I GGWCC 2 cut(s) 38, 219
BmgT120I GGNCC 3 cut(s) 38, 219, 478
BmiI GGNNCC 2 cut(s) 40, 343
BmrFI CCNGG 1 cut(s) 1191
BmsI GCATC 3 cut(s) 311, 1224, 1316
Bpu10I CCTNAGC 2 cut(s) 725, 756
BsaI GGTCTC 1 cut(s) 606
BsaJI CCNNGG 4 cut(s) 424, 504, 595, 622
Bsc4I CCNNNNNNNGG 6 cut(s) 374, 505, 541, 627, 628, 1005
Bse1I ACTGG 1 cut(s) 1116
Bse3DI GCAATG 1 cut(s) 859
BseBI CCWGG 1 cut(s) 1191
BseDI CCNNGG 4 cut(s) 424, 504, 595, 622
BseGI GGATG 2 cut(s) 970, 1335
BseLI CCNNNNNNNGG 6 cut(s) 374, 505, 541, 627, 628, 1005
BseMI GCAATG 1 cut(s) 859
BseMII CTCAG 1 cut(s) 694
BseNI ACTGG 1 cut(s) 1116
BseRI GAGGAG 1 cut(s) 1036
BseSI GKGCMC 1 cut(s) 1159
BseXI GCAGC 3 cut(s) 807, 879, 1013
Bsh1236I CGCG 2 cut(s) 732, 1034
BshFI GGCC 3 cut(s) 304, 447, 479
BsiHKAI GWGCWC 1 cut(s) 1159
BslFI GGGAC 1 cut(s) 24
BslI CCNNNNNNNGG 6 cut(s) 374, 505, 541, 627, 628, 1005
BsmAI GTCTC 1 cut(s) 606
BsmFI GGGAC 1 cut(s) 24
BsmI GAATGC 1 cut(s) 829
BsnI GGCC 3 cut(s) 304, 447, 479
Bso31I GGTCTC 1 cut(s) 606
Bsp1286I GDGCHC 1 cut(s) 1159
Bsp143I GATC 2 cut(s) 341, 807
BspACI CCGC 6 cut(s) 616, 730, 793, 865, 927, 999
BspANI GGCC 3 cut(s) 304, 447, 479
BspCNI CTCAG 1 cut(s) 693
BspFNI CGCG 2 cut(s) 732, 1034
BspLI GGNNCC 2 cut(s) 40, 343
BspPI GGATC 2 cut(s) 336, 349
BspTNI GGTCTC 1 cut(s) 606
BsrDI GCAATG 1 cut(s) 859
BsrI ACTGG 1 cut(s) 1116
BssECI CCNNGG 4 cut(s) 424, 504, 595, 622
BssMI GATC 2 cut(s) 341, 807
BssT1I CCWWGG 3 cut(s) 424, 595, 622
Bst2UI CCWGG 1 cut(s) 1191
Bst6I CTCTTC 1 cut(s) 139
BstC8I GCNNGC 4 cut(s) 157, 1159, 1172, 1196
BstDEI CTNAG 6 cut(s) 121, 253, 680, 725, 756, 1027
BstDSI CCRYGG 1 cut(s) 504
BstF5I GGATG 2 cut(s) 970, 1335
BstFNI CGCG 2 cut(s) 732, 1034
BstHHI GCGC 1 cut(s) 1036
BstKTI GATC 2 cut(s) 344, 810
BstMAI GTCTC 1 cut(s) 606
BstMBI GATC 2 cut(s) 341, 807
BstMWI GCNNNNNNNGC 2 cut(s) 453, 1167
BstNI CCWGG 1 cut(s) 1191
BstNSI RCATGY 1 cut(s) 1174
BstSCI CCNGG 1 cut(s) 1189
BstSLI GKGCMC 1 cut(s) 1159
BstUI CGCG 2 cut(s) 732, 1034
BstV1I GCAGC 3 cut(s) 807, 879, 1013
BstX2I RGATCY 1 cut(s) 341
BstYI RGATCY 1 cut(s) 341
BsuRI GGCC 3 cut(s) 304, 447, 479
BtgI CCRYGG 1 cut(s) 504
BtgZI GCGATG 1 cut(s) 1339
BtsCI GGATG 2 cut(s) 970, 1335
BtsIMutI CAGTG 1 cut(s) 231
Cac8I GCNNGC 4 cut(s) 157, 1159, 1172, 1196
CfoI GCGC 1 cut(s) 1036
Cfr13I GGNCC 3 cut(s) 38, 219, 478
CseI GACGC 1 cut(s) 1040
CviAII CATG 5 cut(s) 63, 1082, 1171, 1204, 1283
DdeI CTNAG 6 cut(s) 121, 253, 680, 725, 756, 1027
DpnI GATC 2 cut(s) 343, 809
DpnII GATC 2 cut(s) 341, 807
DraI TTTAAA 1 cut(s) 271
DraIII CACNNNGTG 1 cut(s) 170
Eam1104I CTCTTC 1 cut(s) 139
EarI CTCTTC 1 cut(s) 139
Eco130I CCWWGG 3 cut(s) 424, 595, 622
Eco147I AGGCCT 1 cut(s) 447
Eco31I GGTCTC 1 cut(s) 606
Eco47I GGWCC 2 cut(s) 38, 219
EcoO109I RGGNCCY 3 cut(s) 38, 219, 478
EcoRI GAATTC 1 cut(s) 359
EcoRII CCWGG 1 cut(s) 1189
EcoT14I CCWWGG 3 cut(s) 424, 595, 622
EcoT22I ATGCAT 2 cut(s) 195, 1331
ErhI CCWWGG 3 cut(s) 424, 595, 622
FaeI CATG 5 cut(s) 66, 1085, 1174, 1207, 1286
FalI AAGNNNNNCTT 2 cut(s) 1010, 1042
FaqI GGGAC 1 cut(s) 24
FatI CATG 5 cut(s) 62, 1081, 1170, 1203, 1282
Fnu4HI GCNGC 8 cut(s) 616, 730, 793, 796, 865, 868, 927, 1002
FokI GGATG 2 cut(s) 957, 1322
Fsp4HI GCNGC 8 cut(s) 616, 730, 793, 796, 865, 868, 927, 1002
FspBI CTAG 7 cut(s) 8, 21, 425, 482, 596, 623, 1353
GlaI GCGC 1 cut(s) 1035
GluI GCNGC 8 cut(s) 616, 730, 793, 796, 865, 868, 927, 1002
HaeIII GGCC 3 cut(s) 304, 447, 479
HgaI GACGC 1 cut(s) 1040
HhaI GCGC 1 cut(s) 1036
Hin1II CATG 5 cut(s) 66, 1085, 1174, 1207, 1286
Hin6I GCGC 1 cut(s) 1034
HinP1I GCGC 1 cut(s) 1034
HincII GTYRAC 1 cut(s) 420
HindII GTYRAC 1 cut(s) 420
HinfI GANTC 5 cut(s) 332, 378, 396, 1262, 1349
HpaI GTTAAC 1 cut(s) 420
Hpy166II GTNNAC 3 cut(s) 420, 1079, 1157
Hpy188I TCNGA 4 cut(s) 294, 561, 588, 1364
Hpy188III TCNNGA 4 cut(s) 8, 21, 200, 1136
Hpy8I GTNNAC 3 cut(s) 420, 1079, 1157
HpyAV CCTTC 8 cut(s) 138, 437, 527, 535, 846, 891, 902, 921
HpyCH4IV ACGT 1 cut(s) 1255
HpyF10VI GCNNNNNNNGC 2 cut(s) 453, 1167
HpyF3I CTNAG 6 cut(s) 121, 253, 680, 725, 756, 1027
HpySE526I ACGT 1 cut(s) 1255
Hsp92II CATG 5 cut(s) 66, 1085, 1174, 1207, 1286
HspAI GCGC 1 cut(s) 1034
KspAI GTTAAC 1 cut(s) 420
Kzo9I GATC 2 cut(s) 341, 807
LmnI GCTCC 2 cut(s) 188, 1023
LpnPI CCDG 7 cut(s) 698, 858, 898, 975, 1129, 1176, 1203
Lsp1109I GCAGC 3 cut(s) 807, 879, 1013
LweI GCATC 3 cut(s) 311, 1224, 1316
MaeI CTAG 7 cut(s) 8, 21, 425, 482, 596, 623, 1353
MaeII ACGT 1 cut(s) 1255
MaeIII GTNAC 3 cut(s) 274, 762, 1216
MalI GATC 2 cut(s) 343, 809
MboI GATC 2 cut(s) 341, 807
MboII GAAGA 3 cut(s) 126, 330, 802
MflI RGATCY 1 cut(s) 341
MhlI GDGCHC 1 cut(s) 1159
MlyI GAGTC 1 cut(s) 341
MnlI CCTC 7 cut(s) 93, 142, 368, 538, 911, 1014, 1080
Mph1103I ATGCAT 2 cut(s) 195, 1331
MseI TTAA 5 cut(s) 57, 209, 270, 419, 1163
MslI CAYNNNNRTG 1 cut(s) 281
MspR9I CCNGG 1 cut(s) 1191
Mva1269I GAATGC 1 cut(s) 829
MvaI CCWGG 1 cut(s) 1191
MvnI CGCG 2 cut(s) 732, 1034
MwoI GCNNNNNNNGC 2 cut(s) 453, 1167
NdeII GATC 2 cut(s) 341, 807
NlaIII CATG 5 cut(s) 66, 1085, 1174, 1207, 1286
NlaIV GGNNCC 2 cut(s) 40, 343
NmuCI GTSAC 2 cut(s) 274, 762
NsiI ATGCAT 2 cut(s) 195, 1331
NspI RCATGY 1 cut(s) 1174
OliI CACNNNNGTG 1 cut(s) 281
PaeI GCATGC 1 cut(s) 1174
PceI AGGCCT 1 cut(s) 447
PctI GAATGC 1 cut(s) 829
PfeI GAWTC 4 cut(s) 378, 396, 1262, 1349
PkrI GCNGC 8 cut(s) 617, 731, 794, 797, 866, 869, 928, 1003
PleI GAGTC 1 cut(s) 340
PpsI GAGTC 1 cut(s) 340
PpuMI RGGWCCY 2 cut(s) 38, 219
PsiI TTATAA 1 cut(s) 299
Psp5II RGGWCCY 2 cut(s) 38, 219
Psp6I CCWGG 1 cut(s) 1189
PspGI CCWGG 1 cut(s) 1189
PspN4I GGNNCC 2 cut(s) 40, 343
PspPI GGNCC 3 cut(s) 38, 219, 478
PspPPI RGGWCCY 2 cut(s) 38, 219
PsuI RGATCY 1 cut(s) 341
RseI CAYNNNNRTG 1 cut(s) 281
SaqAI TTAA 5 cut(s) 57, 209, 270, 419, 1163
SatI GCNGC 8 cut(s) 616, 730, 793, 796, 865, 868, 927, 1002
Sau3AI GATC 2 cut(s) 341, 807
Sau96I GGNCC 3 cut(s) 38, 219, 478
SchI GAGTC 1 cut(s) 341
ScrFI CCNGG 1 cut(s) 1191
SduI GDGCHC 1 cut(s) 1159
SfaNI GCATC 3 cut(s) 311, 1224, 1316
SinI GGWCC 2 cut(s) 38, 219
SmiMI CAYNNNNRTG 1 cut(s) 281
SphI GCATGC 1 cut(s) 1174
SseBI AGGCCT 1 cut(s) 447
SsiI CCGC 6 cut(s) 616, 730, 793, 865, 927, 999
SspI AATATT 1 cut(s) 691
SspMI CTAG 7 cut(s) 8, 21, 425, 482, 596, 623, 1353
StuI AGGCCT 1 cut(s) 447
StyD4I CCNGG 1 cut(s) 1189
StyI CCWWGG 3 cut(s) 424, 595, 622
TaiI ACGT 1 cut(s) 1258
TaqI TCGA 1 cut(s) 1232
TauI GCSGC 5 cut(s) 618, 732, 795, 867, 929
TfiI GAWTC 4 cut(s) 378, 396, 1262, 1349
Tru1I TTAA 5 cut(s) 57, 209, 270, 419, 1163
Tru9I TTAA 5 cut(s) 57, 209, 270, 419, 1163
TscAI CASTG 1 cut(s) 238
TseFI GTSAC 2 cut(s) 274, 762
TseI GCWGC 3 cut(s) 795, 867, 1001
Tsp45I GTSAC 2 cut(s) 274, 762
TspDTI ATGAA 7 cut(s) 372, 647, 657, 683, 1201, 1280, 1324
TspRI CASTG 1 cut(s) 238
VneI GTGCAC 1 cut(s) 1155
VpaK11BI GGWCC 2 cut(s) 38, 219
XapI RAATTY 5 cut(s) 359, 745, 1040, 1178, 1300
XbaI TCTAGA 2 cut(s) 7, 20
XceI RCATGY 1 cut(s) 1174
XmaJI CCTAGG 3 cut(s) 424, 595, 622
XspI CTAG 7 cut(s) 8, 21, 425, 482, 596, 623, 1353
Zsp2I ATGCAT 2 cut(s) 195, 1331
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.