pycom608g00020

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000608
Physical Location & Seq
Reverse (-)
65146 .. 69188
4043 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom608g00020.1

Sequence Viewer

Length: 561 bp
ATGATGAAGGTGGTAGCTAGGGTGAATTATGATGAATGCATTGCATGTGTGTGTGAATGGTGGTGCAATGATGAAAGAGTAAGTGCATGTGTGGCAAACCCATCGAACCTTAGCTTGGAATTGAGCCTTAGCAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGCGCCCTTCTTTCTTATCTTCTAACGGTCTTCTTACAGGTGAAGACTCCGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTTGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTTAA

Protein Analysis

187

Amino Acids

20.64

Weight (kDa)

5.3

Isoelectric Point (pI)

47.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 168
AccBSI CCGCTC 1 cut(s) 387
AccII CGCG 2 cut(s) 146, 151
AciI CCGC 2 cut(s) 149, 385
AclWI GGATC 1 cut(s) 433
AcoI YGGCCR 1 cut(s) 309
AcsI RAATTY 1 cut(s) 543
AcyI GRCGYC 2 cut(s) 169, 228
AdeI CACNNNGTG 1 cut(s) 335
AfaI GTAC 1 cut(s) 455
AfiI CCNNNNNNNGG 3 cut(s) 115, 155, 397
AflII CTTAAG 2 cut(s) 428, 449
AgsI TTSAA 1 cut(s) 317
AjuI GAANNNNNNNTTGG 2 cut(s) 98, 130
AluBI AGCT 7 cut(s) 17, 114, 239, 251, 448, 514, 523
AluI AGCT 7 cut(s) 17, 114, 239, 251, 448, 514, 523
AlwI GGATC 1 cut(s) 433
AoxI GGCC 2 cut(s) 309, 367
ApeKI GCWGC 3 cut(s) 283, 445, 523
ApoI RAATTY 1 cut(s) 543
AscI GGCGCGCC 1 cut(s) 144
AspLEI GCGC 3 cut(s) 146, 148, 171
AspS9I GGNCC 2 cut(s) 297, 367
AsuHPI GGTGA 2 cut(s) 34, 218
AvaII GGWCC 1 cut(s) 297
BanI GGYRCC 1 cut(s) 168
BbsI GAAGAC 2 cut(s) 188, 216
BbvI GCAGC 3 cut(s) 270, 457, 510
BccI CCATC 2 cut(s) 109, 403
BceAI ACGGC 1 cut(s) 296
BcgI CGANNNNNNTGC 2 cut(s) 84, 118
BfaI CTAG 2 cut(s) 18, 252
BfoI RGCGCY 1 cut(s) 172
BfrI CTTAAG 2 cut(s) 428, 449
BisI GCNGC 4 cut(s) 149, 284, 446, 524
BlsI GCNGC 4 cut(s) 150, 285, 447, 525
Bme18I GGWCC 1 cut(s) 297
BmgT120I GGNCC 2 cut(s) 297, 367
BmiI GGNNCC 2 cut(s) 170, 257
BmsI GCATC 1 cut(s) 210
BpiI GAAGAC 2 cut(s) 188, 216
Bpu10I CCTNAGC 2 cut(s) 110, 128
BsaHI GRCGYC 2 cut(s) 169, 228
Bsc4I CCNNNNNNNGG 3 cut(s) 115, 155, 397
Bse3DI GCAATG 2 cut(s) 39, 73
BseLI CCNNNNNNNGG 3 cut(s) 115, 155, 397
BseMI GCAATG 2 cut(s) 39, 73
BseMII CTCAG 1 cut(s) 525
BsePI GCGCGC 1 cut(s) 144
BseRI GAGGAG 1 cut(s) 251
BseXI GCAGC 3 cut(s) 270, 457, 510
Bsh1236I CGCG 2 cut(s) 146, 151
BshFI GGCC 2 cut(s) 311, 369
BshNI GGYRCC 1 cut(s) 168
BslFI GGGAC 1 cut(s) 307
BslI CCNNNNNNNGG 3 cut(s) 115, 155, 397
BsmFI GGGAC 1 cut(s) 307
BsmI GAATGC 1 cut(s) 41
BsnI GGCC 2 cut(s) 311, 369
Bsp143I GATC 1 cut(s) 438
BspACI CCGC 2 cut(s) 149, 385
BspANI GGCC 2 cut(s) 311, 369
BspCNI CTCAG 1 cut(s) 526
BspFNI CGCG 2 cut(s) 146, 151
BspLI GGNNCC 2 cut(s) 170, 257
BspPI GGATC 1 cut(s) 433
BspT107I GGYRCC 1 cut(s) 168
BspTI CTTAAG 2 cut(s) 428, 449
BsrBI CCGCTC 1 cut(s) 387
BsrDI GCAATG 2 cut(s) 39, 73
BssHII GCGCGC 1 cut(s) 144
BssMI GATC 1 cut(s) 438
BssNI GRCGYC 2 cut(s) 169, 228
Bst4CI ACNGT 4 cut(s) 194, 297, 551, 557
Bst6I CTCTTC 1 cut(s) 500
BstACI GRCGYC 2 cut(s) 169, 228
BstAFI CTTAAG 2 cut(s) 428, 449
BstC8I GCNNGC 5 cut(s) 146, 377, 381, 385, 480
BstDEI CTNAG 4 cut(s) 110, 128, 332, 534
BstFNI CGCG 2 cut(s) 146, 151
BstH2I RGCGCY 1 cut(s) 172
BstHHI GCGC 3 cut(s) 146, 148, 171
BstKTI GATC 1 cut(s) 441
BstMBI GATC 1 cut(s) 438
BstMWI GCNNNNNNNGC 3 cut(s) 92, 236, 520
BstNSI RCATGY 3 cut(s) 48, 90, 476
BstUI CGCG 2 cut(s) 146, 151
BstV1I GCAGC 3 cut(s) 270, 457, 510
BstV2I GAAGAC 2 cut(s) 188, 216
BstX2I RGATCY 1 cut(s) 438
BstYI RGATCY 1 cut(s) 438
BsuRI GGCC 2 cut(s) 311, 369
BtsI GCAGTG 1 cut(s) 139
BtsIMutI CAGTG 3 cut(s) 139, 347, 556
Cac8I GCNNGC 5 cut(s) 146, 377, 381, 385, 480
CfoI GCGC 3 cut(s) 146, 148, 171
Cfr13I GGNCC 2 cut(s) 297, 367
CpoI CGGWCCG 1 cut(s) 297
CseI GACGC 2 cut(s) 140, 236
Csp6I GTAC 1 cut(s) 454
CspI CGGWCCG 1 cut(s) 297
CviAII CATG 5 cut(s) 45, 87, 364, 473, 502
CviQI GTAC 1 cut(s) 454
DdeI CTNAG 4 cut(s) 110, 128, 332, 534
DinI GGCGCC 1 cut(s) 170
DpnI GATC 1 cut(s) 440
DpnII GATC 1 cut(s) 438
DraIII CACNNNGTG 1 cut(s) 335
EaeI YGGCCR 1 cut(s) 309
Eam1104I CTCTTC 1 cut(s) 500
EarI CTCTTC 1 cut(s) 500
Eco47I GGWCC 1 cut(s) 297
EcoRI GAATTC 1 cut(s) 543
EcoT22I ATGCAT 1 cut(s) 41
EgeI GGCGCC 1 cut(s) 170
EheI GGCGCC 1 cut(s) 170
FaeI CATG 5 cut(s) 48, 90, 367, 476, 505
FaiI YATR 7 cut(s) 30, 46, 88, 166, 365, 474, 503
FaqI GGGAC 1 cut(s) 307
FatI CATG 5 cut(s) 44, 86, 363, 472, 501
FauI CCCGC 1 cut(s) 392
Fnu4HI GCNGC 4 cut(s) 149, 284, 446, 524
Fsp4HI GCNGC 4 cut(s) 149, 284, 446, 524
FspBI CTAG 2 cut(s) 18, 252
GlaI GCGC 3 cut(s) 145, 147, 170
GluI GCNGC 4 cut(s) 149, 284, 446, 524
HaeII RGCGCY 1 cut(s) 172
HaeIII GGCC 2 cut(s) 311, 369
HgaI GACGC 2 cut(s) 140, 236
HhaI GCGC 3 cut(s) 146, 148, 171
Hin1I GRCGYC 2 cut(s) 169, 228
Hin1II CATG 5 cut(s) 48, 90, 367, 476, 505
Hin6I GCGC 3 cut(s) 144, 146, 169
HinP1I GCGC 3 cut(s) 144, 146, 169
HindIII AAGCTT 1 cut(s) 512
HinfI GANTC 4 cut(s) 212, 320, 401, 530
HphI GGTGA 2 cut(s) 34, 218
Hpy188I TCNGA 2 cut(s) 301, 535
Hpy188III TCNNGA 2 cut(s) 291, 317
HpyAV CCTTC 1 cut(s) 183
HpyCH4III ACNGT 4 cut(s) 194, 297, 551, 557
HpyCH4IV ACGT 1 cut(s) 162
HpyCH4V TGCA 8 cut(s) 39, 44, 66, 86, 223, 472, 482, 526
HpyF10VI GCNNNNNNNGC 3 cut(s) 92, 236, 520
HpyF3I CTNAG 4 cut(s) 110, 128, 332, 534
HpySE526I ACGT 1 cut(s) 162
Hsp92I GRCGYC 2 cut(s) 169, 228
Hsp92II CATG 5 cut(s) 48, 90, 367, 476, 505
HspAI GCGC 3 cut(s) 144, 146, 169
KasI GGCGCC 1 cut(s) 168
Kzo9I GATC 1 cut(s) 438
LmnI GCTCC 1 cut(s) 392
LpnPI CCDG 6 cut(s) 189, 209, 276, 380, 389, 455
Lsp1109I GCAGC 3 cut(s) 270, 457, 510
LweI GCATC 1 cut(s) 210
MaeI CTAG 2 cut(s) 18, 252
MaeII ACGT 1 cut(s) 162
MaeIII GTNAC 2 cut(s) 158, 551
MalI GATC 1 cut(s) 440
MbiI CCGCTC 1 cut(s) 387
MboI GATC 1 cut(s) 438
MboII GAAGA 4 cut(s) 177, 188, 221, 517
MflI RGATCY 1 cut(s) 438
MluCI AATT 3 cut(s) 25, 119, 543
Mly113I GGCGCC 1 cut(s) 169
MlyI GAGTC 2 cut(s) 206, 329
MmeI TCCRAC 1 cut(s) 384
MnlI CCTC 6 cut(s) 269, 272, 335, 409, 501, 529
Mph1103I ATGCAT 1 cut(s) 41
MseI TTAA 3 cut(s) 429, 450, 559
MslI CAYNNNNRTG 1 cut(s) 49
MspCI CTTAAG 2 cut(s) 428, 449
Mva1269I GAATGC 1 cut(s) 41
MvnI CGCG 2 cut(s) 146, 151
MwoI GCNNNNNNNGC 3 cut(s) 92, 236, 520
NarI GGCGCC 1 cut(s) 169
NdeII GATC 1 cut(s) 438
NlaIII CATG 5 cut(s) 48, 90, 367, 476, 505
NlaIV GGNNCC 2 cut(s) 170, 257
NmuCI GTSAC 1 cut(s) 551
NsiI ATGCAT 1 cut(s) 41
NspI RCATGY 3 cut(s) 48, 90, 476
PalAI GGCGCGCC 1 cut(s) 144
PauI GCGCGC 1 cut(s) 144
PctI GAATGC 1 cut(s) 41
PfeI GAWTC 2 cut(s) 401, 530
PkrI GCNGC 4 cut(s) 150, 285, 447, 525
PleI GAGTC 2 cut(s) 206, 328
PluTI GGCGCC 1 cut(s) 172
PpsI GAGTC 2 cut(s) 206, 328
PspN4I GGNNCC 2 cut(s) 170, 257
PspPI GGNCC 2 cut(s) 297, 367
PsuI RGATCY 1 cut(s) 438
PteI GCGCGC 1 cut(s) 144
RsaI GTAC 1 cut(s) 455
RsaNI GTAC 1 cut(s) 454
RseI CAYNNNNRTG 1 cut(s) 49
Rsr2I CGGWCCG 1 cut(s) 297
RsrII CGGWCCG 1 cut(s) 297
SaqAI TTAA 3 cut(s) 429, 450, 559
SatI GCNGC 4 cut(s) 149, 284, 446, 524
Sau3AI GATC 1 cut(s) 438
Sau96I GGNCC 2 cut(s) 297, 367
SchI GAGTC 2 cut(s) 206, 329
SfaNI GCATC 1 cut(s) 210
SfoI GGCGCC 1 cut(s) 170
SgsI GGCGCGCC 1 cut(s) 144
SinI GGWCC 1 cut(s) 297
SmiMI CAYNNNNRTG 1 cut(s) 49
SmlI CTYRAG 2 cut(s) 428, 449
SmoI CTYRAG 2 cut(s) 428, 449
Sse9I AATT 3 cut(s) 25, 119, 543
SsiI CCGC 2 cut(s) 149, 385
SspDI GGCGCC 1 cut(s) 168
SspMI CTAG 2 cut(s) 18, 252
TaaI ACNGT 4 cut(s) 194, 297, 551, 557
TaiI ACGT 1 cut(s) 165
TaqI TCGA 2 cut(s) 104, 541
TasI AATT 3 cut(s) 25, 119, 543
TauI GCSGC 1 cut(s) 151
TfiI GAWTC 2 cut(s) 401, 530
Tru1I TTAA 3 cut(s) 429, 450, 559
Tru9I TTAA 3 cut(s) 429, 450, 559
TscAI CASTG 3 cut(s) 139, 347, 556
TseFI GTSAC 1 cut(s) 551
TseI GCWGC 3 cut(s) 283, 445, 523
Tsp45I GTSAC 1 cut(s) 551
TspDTI ATGAA 4 cut(s) 20, 48, 87, 518
TspGWI ACGGA 1 cut(s) 205
TspRI CASTG 3 cut(s) 139, 347, 556
Vha464I CTTAAG 2 cut(s) 428, 449
VpaK11BI GGWCC 1 cut(s) 297
XapI RAATTY 1 cut(s) 543
XceI RCATGY 3 cut(s) 48, 90, 476
XspI CTAG 2 cut(s) 18, 252
Zsp2I ATGCAT 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.