pycom13g26280

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
22970000 .. 22970869
870 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g26280.4

Sequence Viewer

Length: 648 bp
ATGTTTCTAAGTGTTTTGATTCATTTTGTTACACAAATTCGTCCAAATTTGTGTTTGTGCTCAAATCTGCCCAGAAAGTGGTTTTTAGGCAGATTTGAGTGTGTTTGTGTTGTTTTGAGTCTTTTGGTTTGGTTTAGTGTTTTAAAGTTTACCCCGGTCCAGAACGATCCCTACTTATACATATACTACAATTTGACGAAAAGAGGGTTTAATTTGTGTGCGTATAATTCTCGCATCAGAAAAAAGAAAAAAAAACGTGAAAAAGAAAGAGAAAAGAAGAAAAAGAACTCACAAGTGTTGGTTGTTGAAGAAAGGGTCCAAAAGTTTGAATTTGGCCCTAAGTGTTGTGTGGATTTAAGTGCTTTTTTCATTACTTTGCTTACTATTGCTTTAAGAACTTTTGTTTATCCTTACCTTTCTTTGTTAGCCAATACCTTAGCCCTGTTACAACCATTTGACTTCTATCTTGATTGTTATGTGTTTCAATATGTGGAGTTTAAAAGTGGTATGAGCATATGGTATCCCTGGTTCTTGCGTCTAAGTAGTGGCATTCCATTCATGAGATCATATACATTGCTAGTCTACATATTTACATCAATCTTCTCACATATACCTAGTGTAGGGAGTGTAGTCAGAAAATCTGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

216

Amino Acids

25.46

Weight (kDa)

9.71

Isoelectric Point (pI)

31.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 78
AccI GTMKAC 1 cut(s) 582
AclWI GGATC 1 cut(s) 161
AcsI RAATTY 3 cut(s) 36, 46, 329
AfiI CCNNNNNNNGG 2 cut(s) 78, 620
AgsI TTSAA 3 cut(s) 308, 329, 485
AjnI CCWGG 1 cut(s) 524
Alw21I GWGCWC 1 cut(s) 62
AlwI GGATC 1 cut(s) 161
AoxI GGCC 1 cut(s) 334
ApoI RAATTY 3 cut(s) 36, 46, 329
AspS9I GGNCC 3 cut(s) 157, 316, 335
AsuC2I CCSGG 1 cut(s) 155
AvaII GGWCC 2 cut(s) 157, 316
Bbv12I GWGCWC 1 cut(s) 62
BciT130I CCWGG 1 cut(s) 526
BciVI GTATCC 1 cut(s) 531
BcnI CCSGG 1 cut(s) 155
BfaI CTAG 2 cut(s) 578, 615
BfuI GTATCC 1 cut(s) 531
Bme1390I CCNGG 2 cut(s) 155, 526
Bme18I GGWCC 2 cut(s) 157, 316
BmgT120I GGNCC 3 cut(s) 157, 316, 335
BmiI GGNNCC 1 cut(s) 317
BmrFI CCNGG 2 cut(s) 155, 526
BmsI GCATC 1 cut(s) 243
Bpu10I CCTNAGC 1 cut(s) 436
BpuMI CCSGG 1 cut(s) 155
BsaJI CCNNGG 2 cut(s) 153, 524
Bsc4I CCNNNNNNNGG 2 cut(s) 78, 620
Bse3DI GCAATG 1 cut(s) 572
BseBI CCWGG 1 cut(s) 526
BseDI CCNNGG 2 cut(s) 153, 524
BseLI CCNNNNNNNGG 2 cut(s) 78, 620
BseMI GCAATG 1 cut(s) 572
BshFI GGCC 1 cut(s) 336
BsiHKAI GWGCWC 1 cut(s) 62
BsiSI CCGG 1 cut(s) 155
BslI CCNNNNNNNGG 2 cut(s) 78, 620
BsmI GAATGC 1 cut(s) 549
BsnI GGCC 1 cut(s) 336
Bsp1286I GDGCHC 1 cut(s) 62
Bsp143I GATC 2 cut(s) 166, 563
BspANI GGCC 1 cut(s) 336
BspHI TCATGA 1 cut(s) 558
BspLI GGNNCC 1 cut(s) 317
BspPI GGATC 1 cut(s) 161
BsrDI GCAATG 1 cut(s) 572
BssECI CCNNGG 2 cut(s) 153, 524
BssMI GATC 2 cut(s) 166, 563
Bst2UI CCWGG 1 cut(s) 526
BstDEI CTNAG 4 cut(s) 8, 339, 436, 539
BstENI CCTNNNNNAGG 1 cut(s) 618
BstKTI GATC 2 cut(s) 169, 566
BstMBI GATC 2 cut(s) 166, 563
BstNI CCWGG 1 cut(s) 526
BstSCI CCNGG 2 cut(s) 153, 524
BsuI GTATCC 1 cut(s) 531
BsuRI GGCC 1 cut(s) 336
CciI TCATGA 1 cut(s) 558
Cfr13I GGNCC 3 cut(s) 157, 316, 335
CseI GACGC 1 cut(s) 524
CviAII CATG 1 cut(s) 559
CviJI RGCY 3 cut(s) 336, 428, 440
CviKI_1 RGCY 3 cut(s) 336, 428, 440
DdeI CTNAG 4 cut(s) 8, 339, 436, 539
DpnI GATC 2 cut(s) 168, 565
DpnII GATC 2 cut(s) 166, 563
DraI TTTAAA 2 cut(s) 144, 499
Eco47I GGWCC 2 cut(s) 157, 316
EcoNI CCTNNNNNAGG 1 cut(s) 618
EcoRII CCWGG 1 cut(s) 524
FaeI CATG 1 cut(s) 562
FatI CATG 1 cut(s) 558
FauNDI CATATG 1 cut(s) 515
FblI GTMKAC 1 cut(s) 582
FspBI CTAG 2 cut(s) 578, 615
HaeIII GGCC 1 cut(s) 336
HapII CCGG 1 cut(s) 155
HgaI GACGC 1 cut(s) 524
Hin1II CATG 1 cut(s) 562
HinfI GANTC 2 cut(s) 19, 118
HpaII CCGG 1 cut(s) 155
Hpy166II GTNNAC 2 cut(s) 150, 583
Hpy188I TCNGA 2 cut(s) 239, 635
Hpy188III TCNNGA 3 cut(s) 160, 467, 559
Hpy8I GTNNAC 2 cut(s) 150, 583
HpyCH4IV ACGT 1 cut(s) 256
HpyF3I CTNAG 4 cut(s) 8, 339, 436, 539
HpySE526I ACGT 1 cut(s) 256
Hsp92II CATG 1 cut(s) 562
Kzo9I GATC 2 cut(s) 166, 563
LpnPI CCDG 6 cut(s) 85, 168, 173, 455, 511, 538
LweI GCATC 1 cut(s) 243
MaeI CTAG 2 cut(s) 578, 615
MaeII ACGT 1 cut(s) 256
MaeIII GTNAC 2 cut(s) 28, 444
MalI GATC 2 cut(s) 168, 565
MboI GATC 2 cut(s) 166, 563
MboII GAAGA 3 cut(s) 289, 320, 592
MhlI GDGCHC 1 cut(s) 62
MluCI AATT 6 cut(s) 36, 46, 190, 211, 226, 329
MlyI GAGTC 1 cut(s) 127
MnlI CCTC 1 cut(s) 197
MseI TTAA 5 cut(s) 143, 210, 356, 392, 498
MspI CCGG 1 cut(s) 155
MspR9I CCNGG 2 cut(s) 155, 526
Mva1269I GAATGC 1 cut(s) 549
MvaI CCWGG 1 cut(s) 526
NciI CCSGG 1 cut(s) 155
NdeI CATATG 1 cut(s) 515
NdeII GATC 2 cut(s) 166, 563
NlaIII CATG 1 cut(s) 562
NlaIV GGNNCC 1 cut(s) 317
PagI TCATGA 1 cut(s) 558
PctI GAATGC 1 cut(s) 549
PfeI GAWTC 1 cut(s) 19
PflMI CCANNNNNTGG 1 cut(s) 78
PleI GAGTC 1 cut(s) 126
PpsI GAGTC 1 cut(s) 126
Psp6I CCWGG 1 cut(s) 524
PspGI CCWGG 1 cut(s) 524
PspN4I GGNNCC 1 cut(s) 317
PspPI GGNCC 3 cut(s) 157, 316, 335
PsrI GAACNNNNNNTAC 4 cut(s) 155, 187, 512, 544
SaqAI TTAA 5 cut(s) 143, 210, 356, 392, 498
Sau3AI GATC 2 cut(s) 166, 563
Sau96I GGNCC 3 cut(s) 157, 316, 335
SchI GAGTC 1 cut(s) 127
ScrFI CCNGG 2 cut(s) 155, 526
SduI GDGCHC 1 cut(s) 62
SetI ASST 4 cut(s) 259, 417, 437, 616
SfaNI GCATC 1 cut(s) 243
SinI GGWCC 2 cut(s) 157, 316
Sse9I AATT 6 cut(s) 36, 46, 190, 211, 226, 329
SspMI CTAG 2 cut(s) 578, 615
StyD4I CCNGG 2 cut(s) 153, 524
TaiI ACGT 1 cut(s) 259
TasI AATT 6 cut(s) 36, 46, 190, 211, 226, 329
TfiI GAWTC 1 cut(s) 19
Tru1I TTAA 5 cut(s) 143, 210, 356, 392, 498
Tru9I TTAA 5 cut(s) 143, 210, 356, 392, 498
TspDTI ATGAA 3 cut(s) 11, 358, 547
Van91I CCANNNNNTGG 1 cut(s) 78
VpaK11BI GGWCC 2 cut(s) 157, 316
XagI CCTNNNNNAGG 1 cut(s) 618
XapI RAATTY 3 cut(s) 36, 46, 329
XmiI GTMKAC 1 cut(s) 582
XspI CTAG 2 cut(s) 578, 615
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.