pycom775g00040

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000775
Physical Location & Seq
Reverse (-)
18521 .. 19444
924 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom775g00040.1

Sequence Viewer

Length: 924 bp
ATGGCACTTGATAACGCTTCTCTTTTGTCACAGCTCATGGAAAGGTCCCAAATGCAAAGAGTTGATATATTTAATCTTCAATCAAGGAATAACGTGTTTTCCAATACTTACAATTCGGATTGGAGTGATCATTCAAACTCTATGTGGTGGGAACCTCAAAATGCTCAACAAGGAGGATATTGGCAGCCACCACAACCTCATATTCAATATGCCCAACCAAATTTAAGTTCGTCAATAGATTATAATCAAAAGCTTAACGAATTAATTTGTTTGGTGCAGGGCTCACAAAATCAAGACAATGAGGCTCGACAAGAAGACAAAAGGTTGGATCACTTGGAAAAGCAAATTGGGCAGATAGCGGAGTTCGTAGGACAATTTTGCGACCAAGGCAAACTCCCTAGTTCAACCATTGTAAATCCGAAGGGAGGATTTGAAGCACCTTTGCCGGAAGCACTTATTGCTCCTACGCCATCTAATTCAAGTAAGGTTGTTCCAATTAGTTCTAACCCCATTCCACCTAATATCCCTATTCCTTGCAGGTTCATGAATTCCAAGGAAGAAGAAAGTGAAAAAGACATCTTGGAAGACCTTCCAAAGGTGCAAAGTAGGGAATTTCATGAATTCATCAAAGGGGATATACTTGAGACAACAATGCCCAAAGAAGTTGAATTTGATGACATTGGACAAGTCATAACCATCACATGCAATCTGGCCAAGTCCAATATCCCTGAAACTTTCAAAGGAGTGGTGTTTGTCATTGAGTTCTTGTCAGACAAAACAAGTAAGTCATTTTTTTCAAATTCCATTACATTTTATACTAACTTGTTGTTTTTTATGAATCAGGCACCTACATTAGAATTCAAACCAATGCCGGTTCACTTCAAGTATCACCTTCCATTCAAGGACCAATTCCATGCCGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

308

Amino Acids

35.05

Weight (kDa)

4.99

Isoelectric Point (pI)

49.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 243
Acc36I ACCTGC 1 cut(s) 528
AccB1I GGYRCC 1 cut(s) 844
AciI CCGC 1 cut(s) 359
AclWI GGATC 1 cut(s) 336
AcoI YGGCCR 1 cut(s) 711
AcsI RAATTY 7 cut(s) 220, 547, 611, 620, 668, 799, 857
AfiI CCNNNNNNNGG 2 cut(s) 425, 595
AflIII ACRYGT 1 cut(s) 93
AjuI GAANNNNNNNTTGG 4 cut(s) 211, 243, 330, 362
AluBI AGCT 2 cut(s) 34, 253
AluI AGCT 2 cut(s) 34, 253
Alw26I GTCTC 1 cut(s) 638
AlwI GGATC 1 cut(s) 336
AoxI GGCC 1 cut(s) 711
ApeKI GCWGC 1 cut(s) 184
ApoI RAATTY 7 cut(s) 220, 547, 611, 620, 668, 799, 857
AseI ATTAAT 1 cut(s) 263
Asp700I GAANNNNTTC 1 cut(s) 588
AspS9I GGNCC 2 cut(s) 45, 904
AsuHPI GGTGA 1 cut(s) 881
AvaII GGWCC 2 cut(s) 45, 904
BalI TGGCCA 1 cut(s) 713
BanI GGYRCC 1 cut(s) 844
BanII GRGCYC 1 cut(s) 284
BbsI GAAGAC 2 cut(s) 321, 591
BbvI GCAGC 1 cut(s) 196
BccI CCATC 2 cut(s) 478, 704
BceAI ACGGC 1 cut(s) 902
BclI TGATCA 1 cut(s) 127
BcoDI GTCTC 1 cut(s) 638
BfaI CTAG 1 cut(s) 399
BfuAI ACCTGC 1 cut(s) 528
BisI GCNGC 1 cut(s) 185
BlsI GCNGC 1 cut(s) 186
Bme18I GGWCC 2 cut(s) 45, 904
BmgT120I GGNCC 2 cut(s) 45, 904
BmiI GGNNCC 3 cut(s) 47, 153, 846
BpiI GAAGAC 2 cut(s) 321, 591
BpuEI CTTGAG 1 cut(s) 662
BsaBI GATNNNNATC 1 cut(s) 243
BsaJI CCNNGG 2 cut(s) 385, 552
Bsc4I CCNNNNNNNGG 2 cut(s) 425, 595
Bse118I RCCGGY 1 cut(s) 871
Bse8I GATNNNNATC 1 cut(s) 243
BseDI CCNNGG 2 cut(s) 385, 552
BseJI GATNNNNATC 1 cut(s) 243
BseLI CCNNNNNNNGG 2 cut(s) 425, 595
BseXI GCAGC 1 cut(s) 196
BsgI GTGCAG 1 cut(s) 296
BshFI GGCC 1 cut(s) 713
BshNI GGYRCC 1 cut(s) 844
BsiSI CCGG 2 cut(s) 446, 872
BslFI GGGAC 1 cut(s) 31
BslI CCNNNNNNNGG 2 cut(s) 425, 595
BsmAI GTCTC 1 cut(s) 638
BsmFI GGGAC 1 cut(s) 31
BsnI GGCC 1 cut(s) 713
Bsp1286I GDGCHC 1 cut(s) 284
Bsp143I GATC 2 cut(s) 127, 328
BspACI CCGC 1 cut(s) 359
BspANI GGCC 1 cut(s) 713
BspHI TCATGA 2 cut(s) 543, 616
BspLI GGNNCC 3 cut(s) 47, 153, 846
BspMI ACCTGC 1 cut(s) 528
BspPI GGATC 1 cut(s) 336
BspT107I GGYRCC 1 cut(s) 844
BsrFI RCCGGY 1 cut(s) 871
BssAI RCCGGY 1 cut(s) 871
BssECI CCNNGG 2 cut(s) 385, 552
BssMI GATC 2 cut(s) 127, 328
BssT1I CCWWGG 2 cut(s) 385, 552
BstAPI GCANNNNNTGC 1 cut(s) 458
BstENI CCTNNNNNAGG 1 cut(s) 593
BstKTI GATC 2 cut(s) 130, 331
BstMAI GTCTC 1 cut(s) 638
BstMBI GATC 2 cut(s) 127, 328
BstMWI GCNNNNNNNGC 3 cut(s) 349, 387, 458
BstNSI RCATGY 1 cut(s) 705
BstV1I GCAGC 1 cut(s) 196
BstV2I GAAGAC 2 cut(s) 321, 591
BsuRI GGCC 1 cut(s) 713
BveI ACCTGC 1 cut(s) 528
CciI TCATGA 2 cut(s) 543, 616
Cfr10I RCCGGY 1 cut(s) 871
Cfr13I GGNCC 2 cut(s) 45, 904
CviAII CATG 5 cut(s) 37, 544, 617, 702, 914
CviJI RGCY 6 cut(s) 34, 187, 253, 282, 305, 713
CviKI_1 RGCY 6 cut(s) 34, 187, 253, 282, 305, 713
DpnI GATC 2 cut(s) 129, 330
DpnII GATC 2 cut(s) 127, 328
EaeI YGGCCR 1 cut(s) 711
Eco130I CCWWGG 2 cut(s) 385, 552
Eco24I GRGCYC 1 cut(s) 284
Eco47I GGWCC 2 cut(s) 45, 904
EcoNI CCTNNNNNAGG 1 cut(s) 593
EcoO109I RGGNCCY 1 cut(s) 45
EcoRI GAATTC 3 cut(s) 547, 620, 857
EcoT14I CCWWGG 2 cut(s) 385, 552
EcoT38I GRGCYC 1 cut(s) 284
ErhI CCWWGG 2 cut(s) 385, 552
FaeI CATG 5 cut(s) 40, 547, 620, 705, 917
FaqI GGGAC 1 cut(s) 31
FatI CATG 5 cut(s) 36, 543, 616, 701, 913
FbaI TGATCA 1 cut(s) 127
Fnu4HI GCNGC 1 cut(s) 185
FriOI GRGCYC 1 cut(s) 284
Fsp4HI GCNGC 1 cut(s) 185
FspBI CTAG 1 cut(s) 399
GluI GCNGC 1 cut(s) 185
HaeIII GGCC 1 cut(s) 713
HapII CCGG 2 cut(s) 446, 872
Hin1II CATG 5 cut(s) 40, 547, 620, 705, 917
HindIII AAGCTT 1 cut(s) 251
HinfI GANTC 1 cut(s) 838
HpaII CCGG 2 cut(s) 446, 872
HphI GGTGA 1 cut(s) 881
Hpy166II GTNNAC 1 cut(s) 877
Hpy188I TCNGA 3 cut(s) 118, 420, 772
Hpy188III TCNNGA 3 cut(s) 293, 544, 617
Hpy8I GTNNAC 1 cut(s) 877
HpyAV CCTTC 3 cut(s) 415, 599, 902
HpyCH4IV ACGT 1 cut(s) 93
HpyCH4V TGCA 5 cut(s) 55, 277, 537, 601, 705
HpyF10VI GCNNNNNNNGC 3 cut(s) 349, 387, 458
HpySE526I ACGT 1 cut(s) 93
Hsp92II CATG 5 cut(s) 40, 547, 620, 705, 917
Ksp22I TGATCA 1 cut(s) 127
Kzo9I GATC 2 cut(s) 127, 328
LmnI GCTCC 1 cut(s) 466
LpnPI CCDG 7 cut(s) 263, 459, 523, 695, 741, 827, 885
Lsp1109I GCAGC 1 cut(s) 196
MaeI CTAG 1 cut(s) 399
MaeII ACGT 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 27
MalI GATC 2 cut(s) 129, 330
MboI GATC 2 cut(s) 127, 328
MboII GAAGA 5 cut(s) 68, 326, 569, 572, 596
MhlI GDGCHC 1 cut(s) 284
MlsI TGGCCA 1 cut(s) 713
MluNI TGGCCA 1 cut(s) 713
MmeI TCCRAC 1 cut(s) 306
MnlI CCTC 5 cut(s) 165, 167, 207, 295, 419
Mox20I TGGCCA 1 cut(s) 713
MroXI GAANNNNTTC 1 cut(s) 588
MscI TGGCCA 1 cut(s) 713
MseI TTAA 4 cut(s) 72, 224, 255, 263
Msp20I TGGCCA 1 cut(s) 713
MspI CCGG 2 cut(s) 446, 872
MwoI GCNNNNNNNGC 3 cut(s) 349, 387, 458
NdeII GATC 2 cut(s) 127, 328
NlaIII CATG 5 cut(s) 40, 547, 620, 705, 917
NlaIV GGNNCC 3 cut(s) 47, 153, 846
NmuCI GTSAC 1 cut(s) 27
NspI RCATGY 1 cut(s) 705
PagI TCATGA 2 cut(s) 543, 616
PdmI GAANNNNTTC 1 cut(s) 588
PfeI GAWTC 1 cut(s) 838
PkrI GCNGC 1 cut(s) 186
PpuMI RGGWCCY 1 cut(s) 45
PshBI ATTAAT 1 cut(s) 263
PsiI TTATAA 1 cut(s) 243
Psp5II RGGWCCY 1 cut(s) 45
PspN4I GGNNCC 3 cut(s) 47, 153, 846
PspPI GGNCC 2 cut(s) 45, 904
PspPPI RGGWCCY 1 cut(s) 45
SaqAI TTAA 4 cut(s) 72, 224, 255, 263
SatI GCNGC 1 cut(s) 185
Sau3AI GATC 2 cut(s) 127, 328
Sau96I GGNCC 2 cut(s) 45, 904
SduI GDGCHC 1 cut(s) 284
SinI GGWCC 2 cut(s) 45, 904
SmlI CTYRAG 1 cut(s) 641
SmoI CTYRAG 1 cut(s) 641
SsiI CCGC 1 cut(s) 359
SspMI CTAG 1 cut(s) 399
StyI CCWWGG 2 cut(s) 385, 552
TaiI ACGT 1 cut(s) 96
TaqI TCGA 1 cut(s) 307
TfiI GAWTC 1 cut(s) 838
Tru1I TTAA 4 cut(s) 72, 224, 255, 263
Tru9I TTAA 4 cut(s) 72, 224, 255, 263
TseFI GTSAC 1 cut(s) 27
TseI GCWGC 1 cut(s) 184
Tsp45I GTSAC 1 cut(s) 27
TspDTI ATGAA 6 cut(s) 532, 560, 605, 613, 633, 851
VpaK11BI GGWCC 2 cut(s) 45, 904
VspI ATTAAT 1 cut(s) 263
XagI CCTNNNNNAGG 1 cut(s) 593
XapI RAATTY 7 cut(s) 220, 547, 611, 620, 668, 799, 857
XceI RCATGY 1 cut(s) 705
XmnI GAANNNNTTC 1 cut(s) 588
XspI CTAG 1 cut(s) 399
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.