pycom01g03510

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000120
Physical Location & Seq
Forward (+)
2671271 .. 2672415
1145 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g03510.4

Sequence Viewer

Length: 840 bp
ATGACTGGCAATAGGTGTTTCTTATTGCCCATGGAGGATATGAGTGGTTCTACACTAAAAGCCAGTTGTGAGAGTGATTTGTTATCAGATAAGGAAATGGTGTTGGGGTTACCAAAACTCAAGAAGTCTTCTGGAGTATGTGAAGGATGCATTGCTGGAAAATATAAGCCTTTGGAATTAATCCACTCAGATGTTTGTGGACCAATGCAGGTTACAACATTTGGAGGAAACAGATACTTCTTGACTTTCATTGATGATGCAATCAGAATGTGTTGGGTTTACCTTCTAAATCACAATAGCTACAAAATTCTAGAGTTAAGAAGTGACAGAGATTTGGGGCTTAAGAAACAATTGACAGTGGCCTATTCTCCACAACAAAATGGTGTTGTTGAAAGGAAGAACAAAACCATTGTTGAAATGGCTAAGAGTATGCTTTATGACAAGCACTTGCCTTATAAGTTCTGGGGAGAAGCTGTTAACACAGCTATGTACCTACTCAATAGGTGTCCAACCAAGGTTGTGGAACACAAAACTCTTTTTGAAGCTTTCAGTATCTGTTATGGTCACATACCTGGACAATTAAGACGGAAGTTCGATAAGTCTTCTATGAAAGTTATTTTTGTTGGATATGGGAAGATGGAGAAAGGATCCAAGATCTACAATTTAAGTACCAAGAAGATCTTTTTTGGAATGGAAATCTATGAGATTCATGTGGGATTTCTAGTGACTAGCATGCATATACAATTCAAAATTTATATACGAAAGCAACGGAAGCATGTCATACATTTTATCAAAGCTATAGTCATGCAAATCCCCTTCAAGATGCATAGGTTTATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4219 Retrotran_gag_2 gag_pre-integrs zf-CCHC

Protein Analysis

280

Amino Acids

32.24

Weight (kDa)

9.53

Isoelectric Point (pI)

33.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 456
Acc36I ACCTGC 1 cut(s) 199
AclWI GGATC 2 cut(s) 642, 655
AcsI RAATTY 2 cut(s) 306, 750
AfaI GTAC 2 cut(s) 491, 670
AflII CTTAAG 1 cut(s) 341
AgsI TTSAA 5 cut(s) 392, 416, 542, 748, 820
AjnI CCWGG 1 cut(s) 571
AluBI AGCT 5 cut(s) 300, 473, 485, 545, 797
AluI AGCT 5 cut(s) 300, 473, 485, 545, 797
AlwI GGATC 2 cut(s) 642, 655
AlwNI CAGNNNCTG 1 cut(s) 555
AoxI GGCC 1 cut(s) 360
ApoI RAATTY 2 cut(s) 306, 750
ArsI GACNNNNNNTTYG 2 cut(s) 786, 818
AseI ATTAAT 1 cut(s) 179
AspS9I GGNCC 1 cut(s) 200
AvaII GGWCC 1 cut(s) 200
BamHI GGATCC 1 cut(s) 647
BbsI GAAGAC 2 cut(s) 120, 594
BccI CCATC 1 cut(s) 631
BciT130I CCWGG 1 cut(s) 573
BfaI CTAG 3 cut(s) 311, 722, 729
BfmI CTRYAG 1 cut(s) 798
BfrI CTTAAG 1 cut(s) 341
BfuAI ACCTGC 1 cut(s) 199
BglII AGATCT 2 cut(s) 654, 678
Bme1390I CCNGG 1 cut(s) 573
Bme18I GGWCC 1 cut(s) 200
BmgT120I GGNCC 1 cut(s) 200
BmiI GGNNCC 1 cut(s) 649
BmrFI CCNGG 1 cut(s) 573
BmsI GCATC 3 cut(s) 137, 247, 813
BpiI GAAGAC 2 cut(s) 120, 594
BpmI CTGGAG 1 cut(s) 153
BpuEI CTTGAG 1 cut(s) 104
BsaJI CCNNGG 2 cut(s) 30, 513
BsaXI ACNNNNNCTCC 2 cut(s) 459, 489
Bse1I ACTGG 2 cut(s) 10, 63
Bse3DI GCAATG 1 cut(s) 150
BseBI CCWGG 1 cut(s) 573
BseDI CCNNGG 2 cut(s) 30, 513
BseGI GGATG 1 cut(s) 152
BseMI GCAATG 1 cut(s) 150
BseMII CTCAG 1 cut(s) 201
BseNI ACTGG 2 cut(s) 10, 63
BshFI GGCC 1 cut(s) 362
BsnI GGCC 1 cut(s) 362
Bsp143I GATC 3 cut(s) 647, 654, 678
Bsp19I CCATGG 1 cut(s) 30
BspANI GGCC 1 cut(s) 362
BspCNI CTCAG 1 cut(s) 200
BspLI GGNNCC 1 cut(s) 649
BspMI ACCTGC 1 cut(s) 199
BspPI GGATC 2 cut(s) 642, 655
BspTI CTTAAG 1 cut(s) 341
BsrDI GCAATG 1 cut(s) 150
BsrI ACTGG 2 cut(s) 10, 63
BssECI CCNNGG 2 cut(s) 30, 513
BssMI GATC 3 cut(s) 647, 654, 678
BssT1I CCWWGG 2 cut(s) 30, 513
Bst2UI CCWGG 1 cut(s) 573
Bst4CI ACNGT 1 cut(s) 358
BstAFI CTTAAG 1 cut(s) 341
BstC8I GCNNGC 1 cut(s) 734
BstDEI CTNAG 2 cut(s) 187, 423
BstDSI CCRYGG 1 cut(s) 30
BstEII GGTNACC 1 cut(s) 108
BstF5I GGATG 1 cut(s) 152
BstKTI GATC 3 cut(s) 650, 657, 681
BstMBI GATC 3 cut(s) 647, 654, 678
BstMWI GCNNNNNNNGC 1 cut(s) 772
BstNI CCWGG 1 cut(s) 573
BstNSI RCATGY 2 cut(s) 736, 779
BstPI GGTNACC 1 cut(s) 108
BstSCI CCNGG 1 cut(s) 571
BstSFI CTRYAG 1 cut(s) 798
BstV2I GAAGAC 2 cut(s) 120, 594
BstX2I RGATCY 3 cut(s) 647, 654, 678
BstXI CCANNNNNNTGG 1 cut(s) 520
BstYI RGATCY 3 cut(s) 647, 654, 678
BsuRI GGCC 1 cut(s) 362
BtgI CCRYGG 1 cut(s) 30
BtsCI GGATG 1 cut(s) 152
BtsIMutI CAGTG 1 cut(s) 363
BveI ACCTGC 1 cut(s) 199
Cac8I GCNNGC 1 cut(s) 734
CaiI CAGNNNCTG 1 cut(s) 555
Cfr13I GGNCC 1 cut(s) 200
Csp6I GTAC 2 cut(s) 490, 669
CviAII CATG 5 cut(s) 31, 710, 733, 776, 805
CviQI GTAC 2 cut(s) 490, 669
DdeI CTNAG 2 cut(s) 187, 423
DpnI GATC 3 cut(s) 649, 656, 680
DpnII GATC 3 cut(s) 647, 654, 678
Eco130I CCWWGG 2 cut(s) 30, 513
Eco47I GGWCC 1 cut(s) 200
Eco91I GGTNACC 1 cut(s) 108
EcoO65I GGTNACC 1 cut(s) 108
EcoRII CCWGG 1 cut(s) 571
EcoT14I CCWWGG 2 cut(s) 30, 513
EcoT22I ATGCAT 3 cut(s) 152, 738, 828
ErhI CCWWGG 2 cut(s) 30, 513
FaeI CATG 5 cut(s) 34, 713, 736, 779, 808
FalI AAGNNNNNCTT 2 cut(s) 665, 697
FatI CATG 5 cut(s) 30, 709, 732, 775, 804
FokI GGATG 1 cut(s) 159
FspBI CTAG 3 cut(s) 311, 722, 729
GsuI CTGGAG 1 cut(s) 153
HaeIII GGCC 1 cut(s) 362
Hin1II CATG 5 cut(s) 34, 713, 736, 779, 808
HincII GTYRAC 1 cut(s) 478
HindII GTYRAC 1 cut(s) 478
HindIII AAGCTT 1 cut(s) 543
HinfI GANTC 1 cut(s) 706
HpaI GTTAAC 1 cut(s) 478
Hpy166II GTNNAC 3 cut(s) 200, 280, 478
Hpy188I TCNGA 3 cut(s) 88, 190, 266
Hpy188III TCNNGA 5 cut(s) 121, 132, 241, 311, 820
Hpy8I GTNNAC 3 cut(s) 200, 280, 478
HpyAV CCTTC 3 cut(s) 137, 293, 826
HpyCH4III ACNGT 1 cut(s) 358
HpyCH4V TGCA 6 cut(s) 150, 208, 260, 736, 808, 826
HpyF10VI GCNNNNNNNGC 1 cut(s) 772
HpyF3I CTNAG 2 cut(s) 187, 423
Hsp92II CATG 5 cut(s) 34, 713, 736, 779, 808
KspAI GTTAAC 1 cut(s) 478
Kzo9I GATC 3 cut(s) 647, 654, 678
LpnPI CCDG 7 cut(s) 76, 117, 141, 194, 448, 558, 585
LweI GCATC 3 cut(s) 137, 247, 813
MaeI CTAG 3 cut(s) 311, 722, 729
MaeIII GTNAC 5 cut(s) 108, 211, 323, 563, 724
MalI GATC 3 cut(s) 649, 656, 680
MboI GATC 3 cut(s) 647, 654, 678
MboII GAAGA 5 cut(s) 120, 409, 594, 646, 688
MfeI CAATTG 1 cut(s) 350
MflI RGATCY 3 cut(s) 647, 654, 678
MluCI AATT 7 cut(s) 176, 306, 350, 578, 661, 743, 750
MmeI TCCRAC 2 cut(s) 533, 604
MnlI CCTC 2 cut(s) 28, 218
Mph1103I ATGCAT 3 cut(s) 152, 738, 828
MseI TTAA 6 cut(s) 179, 317, 342, 477, 581, 665
MslI CAYNNNNRTG 2 cut(s) 189, 485
MspCI CTTAAG 1 cut(s) 341
MspR9I CCNGG 1 cut(s) 573
MunI CAATTG 1 cut(s) 350
MvaI CCWGG 1 cut(s) 573
MwoI GCNNNNNNNGC 1 cut(s) 772
NcoI CCATGG 1 cut(s) 30
NdeII GATC 3 cut(s) 647, 654, 678
NlaIII CATG 5 cut(s) 34, 713, 736, 779, 808
NlaIV GGNNCC 1 cut(s) 649
NmuCI GTSAC 3 cut(s) 323, 563, 724
NsiI ATGCAT 3 cut(s) 152, 738, 828
NspI RCATGY 2 cut(s) 736, 779
PaeI GCATGC 1 cut(s) 736
PfeI GAWTC 1 cut(s) 706
PshBI ATTAAT 1 cut(s) 179
PsiI TTATAA 1 cut(s) 456
Psp6I CCWGG 1 cut(s) 571
PspEI GGTNACC 1 cut(s) 108
PspGI CCWGG 1 cut(s) 571
PspN4I GGNNCC 1 cut(s) 649
PspPI GGNCC 1 cut(s) 200
PstNI CAGNNNCTG 1 cut(s) 555
PsuI RGATCY 3 cut(s) 647, 654, 678
RsaI GTAC 2 cut(s) 491, 670
RsaNI GTAC 2 cut(s) 490, 669
RseI CAYNNNNRTG 2 cut(s) 189, 485
SaqAI TTAA 6 cut(s) 179, 317, 342, 477, 581, 665
Sau3AI GATC 3 cut(s) 647, 654, 678
Sau96I GGNCC 1 cut(s) 200
ScrFI CCNGG 1 cut(s) 573
SfaNI GCATC 3 cut(s) 137, 247, 813
SfcI CTRYAG 1 cut(s) 798
SinI GGWCC 1 cut(s) 200
SmiMI CAYNNNNRTG 2 cut(s) 189, 485
SmlI CTYRAG 2 cut(s) 119, 341
SmoI CTYRAG 2 cut(s) 119, 341
SphI GCATGC 1 cut(s) 736
Sse9I AATT 7 cut(s) 176, 306, 350, 578, 661, 743, 750
SspMI CTAG 3 cut(s) 311, 722, 729
StyD4I CCNGG 1 cut(s) 571
StyI CCWWGG 2 cut(s) 30, 513
TaaI ACNGT 1 cut(s) 358
TaqI TCGA 1 cut(s) 594
TasI AATT 7 cut(s) 176, 306, 350, 578, 661, 743, 750
TfiI GAWTC 1 cut(s) 706
Tru1I TTAA 6 cut(s) 179, 317, 342, 477, 581, 665
Tru9I TTAA 6 cut(s) 179, 317, 342, 477, 581, 665
TscAI CASTG 1 cut(s) 363
TseFI GTSAC 3 cut(s) 323, 563, 724
Tsp45I GTSAC 3 cut(s) 323, 563, 724
TspDTI ATGAA 3 cut(s) 238, 623, 698
TspGWI ACGGA 2 cut(s) 601, 784
TspRI CASTG 1 cut(s) 363
Vha464I CTTAAG 1 cut(s) 341
VpaK11BI GGWCC 1 cut(s) 200
VspI ATTAAT 1 cut(s) 179
XapI RAATTY 2 cut(s) 306, 750
XbaI TCTAGA 1 cut(s) 310
XceI RCATGY 2 cut(s) 736, 779
XcmI CCANNNNNNNNNTGG 1 cut(s) 415
XspI CTAG 3 cut(s) 311, 722, 729
Zsp2I ATGCAT 3 cut(s) 152, 738, 828
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.