pycom12g08040

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
8939038 .. 8940208
1171 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g08040.4

Sequence Viewer

Length: 681 bp
ATGCGGCTCCTTTTTACAAAGCTGCACGCGTTTTCTGAAAAGCAGAGAAAGCGTCGCCGAACTTTGCGCTTGTCGGCTAAAGATGTAACGCGTCGCCTAAATTACGCCGGAAATTCCGGCTTTTTGAAATGGTGGACGCGTCCTAAAAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGCTCTGTGTCCAACATGGGCCTACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCGTTGATGGCAGAGGTGGAAAGACTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGGATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTCAAAGGCTTGCGTCTTATCTCCAGAGGCACCTTTTTCCTGGGTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCCGCTCCGATGGCTTCCGCTCCGATGCCTCCCGCTTCTATGCCTCCCGCTTCTGCGCCTCGTAGTGGGGCTTCACGTAAACAACCTTTGGAATTTATCTTTGAATGGGCGGTGATACTTGAAATGATCCGGTAA

Protein Analysis

227

Amino Acids

25.73

Weight (kDa)

10.64

Isoelectric Point (pI)

69.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 477
AccB7I CCANNNNNTGG 1 cut(s) 504
AccBSI CCGCTC 3 cut(s) 279, 551, 566
AccII CGCG 3 cut(s) 29, 91, 139
AciI CCGC 7 cut(s) 4, 277, 549, 564, 579, 594, 656
AclWI GGATC 2 cut(s) 325, 667
AcoI YGGCCR 2 cut(s) 201, 506
AcsI RAATTY 3 cut(s) 112, 435, 638
AdeI CACNNNGTG 1 cut(s) 227
AfaI GTAC 1 cut(s) 347
AfeI AGCGCT 1 cut(s) 502
AfiI CCNNNNNNNGG 3 cut(s) 289, 504, 611
AflII CTTAAG 2 cut(s) 320, 341
AflIII ACRYGT 3 cut(s) 27, 89, 137
AgsI TTSAA 4 cut(s) 127, 209, 650, 668
AjnI CCWGG 2 cut(s) 487, 521
AluBI AGCT 6 cut(s) 22, 243, 340, 406, 415, 536
AluI AGCT 6 cut(s) 22, 243, 340, 406, 415, 536
Alw21I GWGCWC 1 cut(s) 245
AlwI GGATC 2 cut(s) 325, 667
Aor51HI AGCGCT 1 cut(s) 502
AoxI GGCC 4 cut(s) 201, 259, 506, 519
ApeKI GCWGC 4 cut(s) 22, 175, 337, 415
ApoI RAATTY 3 cut(s) 112, 435, 638
AspLEI GCGC 3 cut(s) 69, 503, 604
AspS9I GGNCC 2 cut(s) 189, 259
AsuHPI GGTGA 1 cut(s) 670
AvaII GGWCC 1 cut(s) 189
BalI TGGCCA 1 cut(s) 508
BanI GGYRCC 1 cut(s) 477
BanII GRGCYC 1 cut(s) 245
BarI GAAGNNNNNNTAC 2 cut(s) 601, 633
Bbv12I GWGCWC 1 cut(s) 245
BbvI GCAGC 4 cut(s) 9, 162, 349, 402
BccI CCATC 2 cut(s) 295, 550
BceAI ACGGC 1 cut(s) 188
BciT130I CCWGG 2 cut(s) 489, 523
BfaI CTAG 1 cut(s) 533
BfoI RGCGCY 1 cut(s) 504
BfrI CTTAAG 2 cut(s) 320, 341
BisI GCNGC 5 cut(s) 5, 23, 176, 338, 416
BlsI GCNGC 5 cut(s) 6, 24, 177, 339, 417
Bme1390I CCNGG 2 cut(s) 489, 523
Bme18I GGWCC 1 cut(s) 189
BmgT120I GGNCC 2 cut(s) 189, 259
BmiI GGNNCC 2 cut(s) 8, 479
BmrFI CCNGG 2 cut(s) 489, 523
BmsI GCATC 2 cut(s) 531, 561
BpmI CTGGAG 1 cut(s) 455
BsaAI YACGTR 1 cut(s) 623
BsaJI CCNNGG 1 cut(s) 488
BsaWI WCCGGW 1 cut(s) 675
Bsc4I CCNNNNNNNGG 3 cut(s) 289, 504, 611
BseBI CCWGG 2 cut(s) 489, 523
BseDI CCNNGG 1 cut(s) 488
BseGI GGATG 2 cut(s) 399, 494
BseLI CCNNNNNNNGG 3 cut(s) 289, 504, 611
BseMII CTCAG 1 cut(s) 417
BseRI GAGGAG 1 cut(s) 143
BseXI GCAGC 4 cut(s) 9, 162, 349, 402
BsgI GTGCAG 1 cut(s) 8
Bsh1236I CGCG 3 cut(s) 29, 91, 139
BshFI GGCC 4 cut(s) 203, 261, 508, 521
BshNI GGYRCC 1 cut(s) 477
BsiHKAI GWGCWC 1 cut(s) 245
BsiSI CCGG 3 cut(s) 108, 117, 676
BslFI GGGAC 1 cut(s) 199
BslI CCNNNNNNNGG 3 cut(s) 289, 504, 611
BsmFI GGGAC 1 cut(s) 199
BsmI GAATGC 1 cut(s) 532
BsnI GGCC 4 cut(s) 203, 261, 508, 521
Bsp1286I GDGCHC 1 cut(s) 245
Bsp143I GATC 2 cut(s) 330, 672
BspACI CCGC 7 cut(s) 4, 277, 549, 564, 579, 594, 656
BspANI GGCC 4 cut(s) 203, 261, 508, 521
BspCNI CTCAG 1 cut(s) 418
BspFNI CGCG 3 cut(s) 29, 91, 139
BspLI GGNNCC 2 cut(s) 8, 479
BspPI GGATC 2 cut(s) 325, 667
BspT107I GGYRCC 1 cut(s) 477
BspTI CTTAAG 2 cut(s) 320, 341
BsrBI CCGCTC 3 cut(s) 279, 551, 566
BssECI CCNNGG 1 cut(s) 488
BssMI GATC 2 cut(s) 330, 672
Bst2UI CCWGG 2 cut(s) 489, 523
Bst4CI ACNGT 3 cut(s) 189, 443, 449
Bst6I CTCTTC 1 cut(s) 392
BstAFI CTTAAG 2 cut(s) 320, 341
BstBAI YACGTR 1 cut(s) 623
BstC8I GCNNGC 7 cut(s) 27, 241, 269, 273, 277, 372, 459
BstDEI CTNAG 2 cut(s) 224, 426
BstF5I GGATG 2 cut(s) 399, 494
BstFNI CGCG 3 cut(s) 29, 91, 139
BstH2I RGCGCY 1 cut(s) 504
BstHHI GCGC 3 cut(s) 69, 503, 604
BstKTI GATC 2 cut(s) 333, 675
BstMBI GATC 2 cut(s) 330, 672
BstMWI GCNNNNNNNGC 4 cut(s) 49, 412, 527, 557
BstNI CCWGG 2 cut(s) 489, 523
BstNSI RCATGY 1 cut(s) 368
BstSCI CCNGG 2 cut(s) 487, 521
BstUI CGCG 3 cut(s) 29, 91, 139
BstV1I GCAGC 4 cut(s) 9, 162, 349, 402
BstX2I RGATCY 1 cut(s) 330
BstYI RGATCY 1 cut(s) 330
BsuRI GGCC 4 cut(s) 203, 261, 508, 521
BtsCI GGATG 2 cut(s) 399, 494
BtsIMutI CAGTG 2 cut(s) 239, 448
Cac8I GCNNGC 7 cut(s) 27, 241, 269, 273, 277, 372, 459
CfoI GCGC 3 cut(s) 69, 503, 604
Cfr13I GGNCC 2 cut(s) 189, 259
CpoI CGGWCCG 1 cut(s) 189
CseI GACGC 5 cut(s) 41, 80, 128, 145, 450
Csp6I GTAC 1 cut(s) 346
CspI CGGWCCG 1 cut(s) 189
CviAII CATG 2 cut(s) 256, 365
CviQI GTAC 1 cut(s) 346
DdeI CTNAG 2 cut(s) 224, 426
DpnI GATC 2 cut(s) 332, 674
DpnII GATC 2 cut(s) 330, 672
DraIII CACNNNGTG 1 cut(s) 227
EaeI YGGCCR 2 cut(s) 201, 506
Eam1104I CTCTTC 1 cut(s) 392
EarI CTCTTC 1 cut(s) 392
Ecl136II GAGCTC 1 cut(s) 243
Eco147I AGGCCT 1 cut(s) 521
Eco24I GRGCYC 1 cut(s) 245
Eco47I GGWCC 1 cut(s) 189
Eco47III AGCGCT 1 cut(s) 502
Eco53kI GAGCTC 1 cut(s) 243
EcoICRI GAGCTC 1 cut(s) 243
EcoRI GAATTC 1 cut(s) 435
EcoRII CCWGG 2 cut(s) 487, 521
EcoT38I GRGCYC 1 cut(s) 245
FaeI CATG 2 cut(s) 259, 368
FaiI YATR 3 cut(s) 257, 366, 587
FaqI GGGAC 1 cut(s) 199
FatI CATG 2 cut(s) 255, 364
FauI CCCGC 4 cut(s) 284, 556, 586, 601
Fnu4HI GCNGC 5 cut(s) 5, 23, 176, 338, 416
FokI GGATG 2 cut(s) 406, 481
FriOI GRGCYC 1 cut(s) 245
Fsp4HI GCNGC 5 cut(s) 5, 23, 176, 338, 416
FspBI CTAG 1 cut(s) 533
GlaI GCGC 3 cut(s) 68, 502, 603
GluI GCNGC 5 cut(s) 5, 23, 176, 338, 416
GsuI CTGGAG 1 cut(s) 455
HaeII RGCGCY 1 cut(s) 504
HaeIII GGCC 4 cut(s) 203, 261, 508, 521
HapII CCGG 3 cut(s) 108, 117, 676
HgaI GACGC 5 cut(s) 41, 80, 128, 145, 450
HhaI GCGC 3 cut(s) 69, 503, 604
Hin1II CATG 2 cut(s) 259, 368
Hin6I GCGC 3 cut(s) 67, 501, 602
HinP1I GCGC 3 cut(s) 67, 501, 602
HindIII AAGCTT 1 cut(s) 404
HinfI GANTC 3 cut(s) 212, 293, 422
HpaII CCGG 3 cut(s) 108, 117, 676
HphI GGTGA 1 cut(s) 670
Hpy166II GTNNAC 2 cut(s) 135, 626
Hpy188I TCNGA 6 cut(s) 37, 193, 427, 540, 555, 570
Hpy188III TCNNGA 3 cut(s) 183, 209, 472
Hpy8I GTNNAC 2 cut(s) 135, 626
Hpy99I CGWCG 3 cut(s) 57, 96, 391
HpyCH4III ACNGT 3 cut(s) 189, 443, 449
HpyCH4IV ACGT 1 cut(s) 622
HpyCH4V TGCA 4 cut(s) 25, 364, 374, 418
HpyF10VI GCNNNNNNNGC 4 cut(s) 49, 412, 527, 557
HpyF3I CTNAG 2 cut(s) 224, 426
HpySE526I ACGT 1 cut(s) 622
Hsp92II CATG 2 cut(s) 259, 368
HspAI GCGC 3 cut(s) 67, 501, 602
Kzo9I GATC 2 cut(s) 330, 672
LmnI GCTCC 5 cut(s) 12, 284, 541, 556, 571
Lsp1109I GCAGC 4 cut(s) 9, 162, 349, 402
LweI GCATC 2 cut(s) 531, 561
MaeI CTAG 1 cut(s) 533
MaeII ACGT 1 cut(s) 622
MaeIII GTNAC 2 cut(s) 85, 443
MalI GATC 2 cut(s) 332, 674
MbiI CCGCTC 3 cut(s) 279, 551, 566
MboI GATC 2 cut(s) 330, 672
MboII GAAGA 1 cut(s) 409
MflI RGATCY 1 cut(s) 330
MhlI GDGCHC 1 cut(s) 245
MlsI TGGCCA 1 cut(s) 508
MluCI AATT 4 cut(s) 100, 112, 435, 638
MluI ACGCGT 3 cut(s) 27, 89, 137
MluNI TGGCCA 1 cut(s) 508
MlyI GAGTC 1 cut(s) 221
MmeI TCCRAC 1 cut(s) 276
Mox20I TGGCCA 1 cut(s) 508
MscI TGGCCA 1 cut(s) 508
MseI TTAA 2 cut(s) 321, 342
Msp20I TGGCCA 1 cut(s) 508
MspCI CTTAAG 2 cut(s) 320, 341
MspI CCGG 3 cut(s) 108, 117, 676
MspR9I CCNGG 2 cut(s) 489, 523
Mva1269I GAATGC 1 cut(s) 532
MvaI CCWGG 2 cut(s) 489, 523
MvnI CGCG 3 cut(s) 29, 91, 139
MwoI GCNNNNNNNGC 4 cut(s) 49, 412, 527, 557
NdeII GATC 2 cut(s) 330, 672
NlaIII CATG 2 cut(s) 259, 368
NlaIV GGNNCC 2 cut(s) 8, 479
NmuCI GTSAC 1 cut(s) 443
NspI RCATGY 1 cut(s) 368
PceI AGGCCT 1 cut(s) 521
PctI GAATGC 1 cut(s) 532
PfeI GAWTC 2 cut(s) 293, 422
PflMI CCANNNNNTGG 1 cut(s) 504
PkrI GCNGC 5 cut(s) 6, 24, 177, 339, 417
PleI GAGTC 1 cut(s) 220
PpsI GAGTC 1 cut(s) 220
Ppu21I YACGTR 1 cut(s) 623
Psp124BI GAGCTC 1 cut(s) 245
Psp6I CCWGG 2 cut(s) 487, 521
PspGI CCWGG 2 cut(s) 487, 521
PspN4I GGNNCC 2 cut(s) 8, 479
PspPI GGNCC 2 cut(s) 189, 259
PsuI RGATCY 1 cut(s) 330
RsaI GTAC 1 cut(s) 347
RsaNI GTAC 1 cut(s) 346
Rsr2I CGGWCCG 1 cut(s) 189
RsrII CGGWCCG 1 cut(s) 189
SacI GAGCTC 1 cut(s) 245
SaqAI TTAA 2 cut(s) 321, 342
SatI GCNGC 5 cut(s) 5, 23, 176, 338, 416
Sau3AI GATC 2 cut(s) 330, 672
Sau96I GGNCC 2 cut(s) 189, 259
SchI GAGTC 1 cut(s) 221
ScrFI CCNGG 2 cut(s) 489, 523
SduI GDGCHC 1 cut(s) 245
SfaNI GCATC 2 cut(s) 531, 561
SinI GGWCC 1 cut(s) 189
SmlI CTYRAG 2 cut(s) 320, 341
SmoI CTYRAG 2 cut(s) 320, 341
Sse9I AATT 4 cut(s) 100, 112, 435, 638
SseBI AGGCCT 1 cut(s) 521
SsiI CCGC 7 cut(s) 4, 277, 549, 564, 579, 594, 656
SspMI CTAG 1 cut(s) 533
SstI GAGCTC 1 cut(s) 245
StuI AGGCCT 1 cut(s) 521
StyD4I CCNGG 2 cut(s) 487, 521
TaaI ACNGT 3 cut(s) 189, 443, 449
TaiI ACGT 1 cut(s) 625
TaqI TCGA 1 cut(s) 433
TasI AATT 4 cut(s) 100, 112, 435, 638
TauI GCSGC 1 cut(s) 7
TfiI GAWTC 2 cut(s) 293, 422
Tru1I TTAA 2 cut(s) 321, 342
Tru9I TTAA 2 cut(s) 321, 342
TscAI CASTG 2 cut(s) 239, 448
TseFI GTSAC 1 cut(s) 443
TseI GCWGC 4 cut(s) 22, 175, 337, 415
Tsp45I GTSAC 1 cut(s) 443
TspDTI ATGAA 1 cut(s) 410
TspRI CASTG 2 cut(s) 239, 448
Van91I CCANNNNNTGG 1 cut(s) 504
Vha464I CTTAAG 2 cut(s) 320, 341
VpaK11BI GGWCC 1 cut(s) 189
XapI RAATTY 3 cut(s) 112, 435, 638
XceI RCATGY 1 cut(s) 368
XspI CTAG 1 cut(s) 533
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.