pycom04g13700

ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Reverse (-)
16678446 .. 16678786
341 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g13700.2

Sequence Viewer

Length: 297 bp
ATGGCTTGCCCATCTAACATTTGCTTAGATTTGAGTCTCAGGATTGATACAGACGAGCAGCGTCAGGATAACATATGGCGCTCGTCCTTCTCATCTTCTAATGGTCCTCTTACGGTTGGGGACTCTGTGATGAAAAATAACATAACTGCTACAGTGGTAGCCAGGAATTTTCTCACTCCAAAGGACAACATAATCCTTTCAAACCGGTCTGATGAAGCGGCCGTTCAAGACTCATTGGCACTCAGTGTTCAATGTGCGGGCTCTGTATCCAATATGGGCCAGCGTGGCAAGTCTTAA

Protein Analysis

99

Amino Acids

10.53

Weight (kDa)

5.12

Isoelectric Point (pI)

63.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 218, 257
AcoI YGGCCR 1 cut(s) 219
AcsI RAATTY 1 cut(s) 166
AdeI CACNNNGTG 1 cut(s) 245
AgeI ACCGGT 1 cut(s) 204
AgsI TTSAA 3 cut(s) 201, 227, 251
AjnI CCWGG 1 cut(s) 161
Alw26I GTCTC 1 cut(s) 41
AoxI GGCC 2 cut(s) 219, 277
ApeKI GCWGC 1 cut(s) 58
ApoI RAATTY 1 cut(s) 166
AsiGI ACCGGT 1 cut(s) 204
AspLEI GCGC 1 cut(s) 81
AspS9I GGNCC 2 cut(s) 104, 277
AvaII GGWCC 1 cut(s) 104
BanII GRGCYC 1 cut(s) 263
BbvI GCAGC 1 cut(s) 70
BccI CCATC 1 cut(s) 19
BceAI ACGGC 1 cut(s) 206
BciT130I CCWGG 1 cut(s) 163
BciVI GTATCC 1 cut(s) 277
BcoDI GTCTC 1 cut(s) 41
BfmI CTRYAG 1 cut(s) 150
BfoI RGCGCY 1 cut(s) 82
BfuI GTATCC 1 cut(s) 277
BglI GCCNNNNNGGC 1 cut(s) 285
BisI GCNGC 2 cut(s) 59, 219
BlsI GCNGC 2 cut(s) 60, 220
Bme1390I CCNGG 1 cut(s) 163
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 2 cut(s) 104, 277
BmrFI CCNGG 1 cut(s) 163
BsaWI WCCGGW 1 cut(s) 204
Bse118I RCCGGY 1 cut(s) 204
BseBI CCWGG 1 cut(s) 163
BseMII CTCAG 2 cut(s) 52, 256
BseX3I CGGCCG 1 cut(s) 219
BseXI GCAGC 1 cut(s) 70
Bsh1285I CGRYCG 1 cut(s) 222
BshFI GGCC 2 cut(s) 221, 279
BshTI ACCGGT 1 cut(s) 204
BsiEI CGRYCG 1 cut(s) 222
BsiSI CCGG 1 cut(s) 205
BslFI GGGAC 1 cut(s) 134
BsmAI GTCTC 1 cut(s) 41
BsmFI GGGAC 1 cut(s) 134
BsnI GGCC 2 cut(s) 221, 279
Bsp1286I GDGCHC 1 cut(s) 263
BspACI CCGC 2 cut(s) 218, 257
BspANI GGCC 2 cut(s) 221, 279
BspCNI CTCAG 2 cut(s) 51, 255
BsrFI RCCGGY 1 cut(s) 204
BssAI RCCGGY 1 cut(s) 204
Bst2UI CCWGG 1 cut(s) 163
Bst4CI ACNGT 2 cut(s) 115, 154
BstC8I GCNNGC 3 cut(s) 7, 259, 281
BstDEI CTNAG 3 cut(s) 25, 38, 242
BstH2I RGCGCY 1 cut(s) 82
BstHHI GCGC 1 cut(s) 81
BstMAI GTCTC 1 cut(s) 41
BstMCI CGRYCG 1 cut(s) 222
BstMWI GCNNNNNNNGC 1 cut(s) 285
BstNI CCWGG 1 cut(s) 163
BstSCI CCNGG 1 cut(s) 161
BstSFI CTRYAG 1 cut(s) 150
BstV1I GCAGC 1 cut(s) 70
BstZI CGGCCG 1 cut(s) 219
BsuI GTATCC 1 cut(s) 277
BsuRI GGCC 2 cut(s) 221, 279
BtsIMutI CAGTG 2 cut(s) 159, 250
Cac8I GCNNGC 3 cut(s) 7, 259, 281
CfoI GCGC 1 cut(s) 81
Cfr10I RCCGGY 1 cut(s) 204
Cfr13I GGNCC 2 cut(s) 104, 277
CseI GACGC 1 cut(s) 50
CspAI ACCGGT 1 cut(s) 204
CviJI RGCY 5 cut(s) 5, 161, 221, 261, 279
CviKI_1 RGCY 5 cut(s) 5, 161, 221, 261, 279
DdeI CTNAG 3 cut(s) 25, 38, 242
DraIII CACNNNGTG 1 cut(s) 245
EaeI YGGCCR 1 cut(s) 219
EagI CGGCCG 1 cut(s) 219
EclXI CGGCCG 1 cut(s) 219
Eco24I GRGCYC 1 cut(s) 263
Eco47I GGWCC 1 cut(s) 104
Eco52I CGGCCG 1 cut(s) 219
EcoRII CCWGG 1 cut(s) 161
EcoT38I GRGCYC 1 cut(s) 263
FaiI YATR 5 cut(s) 74, 76, 143, 191, 275
FaqI GGGAC 1 cut(s) 134
FauI CCCGC 1 cut(s) 250
FauNDI CATATG 1 cut(s) 74
Fnu4HI GCNGC 2 cut(s) 59, 219
FriOI GRGCYC 1 cut(s) 263
Fsp4HI GCNGC 2 cut(s) 59, 219
GlaI GCGC 1 cut(s) 80
GluI GCNGC 2 cut(s) 59, 219
HaeII RGCGCY 1 cut(s) 82
HaeIII GGCC 2 cut(s) 221, 279
HapII CCGG 1 cut(s) 205
HgaI GACGC 1 cut(s) 50
HhaI GCGC 1 cut(s) 81
Hin6I GCGC 1 cut(s) 79
HinP1I GCGC 1 cut(s) 79
HinfI GANTC 3 cut(s) 34, 122, 230
HpaII CCGG 1 cut(s) 205
Hpy188I TCNGA 1 cut(s) 211
Hpy188III TCNNGA 3 cut(s) 40, 65, 227
HpyAV CCTTC 1 cut(s) 97
HpyCH4III ACNGT 2 cut(s) 115, 154
HpyF10VI GCNNNNNNNGC 1 cut(s) 285
HpyF3I CTNAG 3 cut(s) 25, 38, 242
HspAI GCGC 1 cut(s) 79
LpnPI CCDG 6 cut(s) 25, 50, 148, 175, 218, 293
Lsp1109I GCAGC 1 cut(s) 70
MboII GAAGA 1 cut(s) 87
MhlI GDGCHC 1 cut(s) 263
MluCI AATT 1 cut(s) 166
MlyI GAGTC 3 cut(s) 43, 116, 224
MnlI CCTC 1 cut(s) 117
MseI TTAA 1 cut(s) 295
MspI CCGG 1 cut(s) 205
MspR9I CCNGG 1 cut(s) 163
MvaI CCWGG 1 cut(s) 163
MwoI GCNNNNNNNGC 1 cut(s) 285
NdeI CATATG 1 cut(s) 74
PinAI ACCGGT 1 cut(s) 204
PkrI GCNGC 2 cut(s) 60, 220
PleI GAGTC 3 cut(s) 42, 116, 224
PpsI GAGTC 3 cut(s) 42, 116, 224
Psp6I CCWGG 1 cut(s) 161
PspGI CCWGG 1 cut(s) 161
PspPI GGNCC 2 cut(s) 104, 277
SaqAI TTAA 1 cut(s) 295
SatI GCNGC 2 cut(s) 59, 219
Sau96I GGNCC 2 cut(s) 104, 277
SchI GAGTC 3 cut(s) 43, 116, 224
ScrFI CCNGG 1 cut(s) 163
SduI GDGCHC 1 cut(s) 263
SfcI CTRYAG 1 cut(s) 150
SinI GGWCC 1 cut(s) 104
Sse9I AATT 1 cut(s) 166
SsiI CCGC 2 cut(s) 218, 257
StyD4I CCNGG 1 cut(s) 161
TaaI ACNGT 2 cut(s) 115, 154
TasI AATT 1 cut(s) 166
TauI GCSGC 1 cut(s) 221
Tru1I TTAA 1 cut(s) 295
Tru9I TTAA 1 cut(s) 295
TscAI CASTG 2 cut(s) 159, 250
TseI GCWGC 1 cut(s) 58
TspDTI ATGAA 2 cut(s) 146, 228
TspRI CASTG 2 cut(s) 159, 250
VpaK11BI GGWCC 1 cut(s) 104
XapI RAATTY 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.