MD14G1073500.v1.1

RRP12-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0000120
Physical Location & Seq
Forward (+)
8149641 .. 8151058
1418 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1073500.v1.1.491

Sequence Viewer

Length: 900 bp
ATGTCTGGCCCCTCCGACCGTCGTTTTGACTTGAACCTTGTTGAAGAGGCAGCCCCGCCTTCTCCAGACAACATATGGCGCCCATCCTTCGTCTCCCCTACTGGTCCTCTTACCGTTGGGGATTCCGTGATGAAGAATGATATGACTGCTGCGGTAGTGGCCAGGAACCTTCTCACTCCCAAAGATAACAGACTACTTTCCAAACGGTCTGATGAGTTGGCTGTTAAGGATTCTCTGGCTCTCAGTGTTCAGTGTGCAGGTTCTGTGTCTAATATGGCCCAACGCCTATTTGCTCGAACCCGCCAAGTTGAATCATTGGCGGCTGAAGTGATGAGTCTCAAACAGGAGATTAGAGGGCTCAAGCATGAGAATAAACAGTTGCACCGGCTCGCCCATGACTATGCTACAAACATGAAGAGGAAGCTTGACCAGATGAAGGAATCTGATGGTCAGAGCCGCCATAACAAGAAATCTTCCAAGGAAGTTGCCACAACCGATATAGACACGGGCCATGTAAGCACTTCAACCAACAGGACGGAGGATAAAAAGCGCAAGAGGTTTGGTAAGCCACATGAAAAGAATGGATTGATGGAACATAGAGAGATGAAAAGGGTGAAGAAACACATTCCTGACAACCATAGAACCAACGAGCTTCGTACTTCTGGCGGTGATGGATTCAAGCGGACTTATAAAGGTAGGCAATCTGATAGAGTAAAATCAAATAAAGACCCTTCAGAAAGAAGTGGAAAGACAAATAAAGAAAAATATAGTAAAGGGCCCGCAAGTGGCTTCAAGAGGAAGATGGATAGCACTAATACGAGGAAGGATGCAGCTGCAAGTCCGAGACCTTGCACTTCATCCAAATCATTGGAACACAAGAAGGTTGGGAGAAAACACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NUC173

Protein Analysis

300

Amino Acids

33.63

Weight (kDa)

10.19

Isoelectric Point (pI)

52.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 690
Acc36I ACCTGC 1 cut(s) 248
AccB1I GGYRCC 1 cut(s) 78
AciI CCGC 8 cut(s) 56, 152, 301, 320, 457, 666, 682, 780
AcoI YGGCCR 1 cut(s) 159
AcuI CTGAAG 2 cut(s) 345, 717
AcyI GRCGYC 1 cut(s) 79
AfaI GTAC 1 cut(s) 658
AfiI CCNNNNNNNGG 2 cut(s) 436, 785
AgsI TTSAA 6 cut(s) 34, 44, 311, 525, 679, 793
AjnI CCWGG 1 cut(s) 161
AluBI AGCT 3 cut(s) 424, 652, 833
AluI AGCT 3 cut(s) 424, 652, 833
Alw26I GTCTC 3 cut(s) 97, 341, 838
AlwNI CAGNNNCTG 1 cut(s) 263
AoxI GGCC 5 cut(s) 7, 159, 276, 508, 776
ApaI GGGCCC 1 cut(s) 780
ApeKI GCWGC 4 cut(s) 50, 149, 830, 833
ArsI GACNNNNNNTTYG 2 cut(s) 8, 40
AspLEI GCGC 2 cut(s) 81, 552
AspS9I GGNCC 6 cut(s) 8, 104, 277, 508, 776, 777
AsuHPI GGTGA 2 cut(s) 625, 680
AvaII GGWCC 1 cut(s) 104
BaeGI GKGCMC 1 cut(s) 780
BalI TGGCCA 1 cut(s) 161
BanI GGYRCC 1 cut(s) 78
BanII GRGCYC 2 cut(s) 360, 780
BbvI GCAGC 4 cut(s) 62, 136, 820, 842
BccI CCATC 5 cut(s) 91, 440, 583, 665, 796
BciT130I CCWGG 1 cut(s) 163
BcoDI GTCTC 3 cut(s) 97, 341, 838
BfaI CTAG 1 cut(s) 898
BfoI RGCGCY 1 cut(s) 82
BfuAI ACCTGC 1 cut(s) 248
BisI GCNGC 6 cut(s) 51, 150, 321, 457, 831, 834
BlsI GCNGC 6 cut(s) 52, 151, 322, 458, 832, 835
Bme1390I CCNGG 1 cut(s) 163
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 6 cut(s) 8, 104, 277, 508, 776, 777
BmiI GGNNCC 4 cut(s) 10, 80, 167, 778
BmrFI CCNGG 1 cut(s) 163
BmsI GCATC 1 cut(s) 817
BpmI CTGGAG 1 cut(s) 48
BpuEI CTTGAG 1 cut(s) 344
BsaHI GRCGYC 1 cut(s) 79
BsaI GGTCTC 1 cut(s) 838
BsaJI CCNNGG 1 cut(s) 477
Bsc4I CCNNNNNNNGG 2 cut(s) 436, 785
Bse118I RCCGGY 1 cut(s) 384
Bse1I ACTGG 1 cut(s) 106
BseBI CCWGG 1 cut(s) 163
BseDI CCNNGG 1 cut(s) 477
BseGI GGATG 3 cut(s) 83, 832, 857
BseLI CCNNNNNNNGG 2 cut(s) 436, 785
BseMII CTCAG 1 cut(s) 256
BseNI ACTGG 1 cut(s) 106
BseSI GKGCMC 1 cut(s) 780
BseXI GCAGC 4 cut(s) 62, 136, 820, 842
BsgI GTGCAG 1 cut(s) 276
Bsh1285I CGRYCG 1 cut(s) 19
BshFI GGCC 5 cut(s) 9, 161, 278, 510, 778
BshNI GGYRCC 1 cut(s) 78
BsiEI CGRYCG 1 cut(s) 19
BsiSI CCGG 1 cut(s) 385
BslI CCNNNNNNNGG 2 cut(s) 436, 785
BsmAI GTCTC 3 cut(s) 97, 341, 838
BsmBI CGTCTC 1 cut(s) 97
BsnI GGCC 5 cut(s) 9, 161, 278, 510, 778
Bso31I GGTCTC 1 cut(s) 838
Bsp120I GGGCCC 1 cut(s) 776
Bsp1286I GDGCHC 2 cut(s) 360, 780
BspACI CCGC 8 cut(s) 56, 152, 301, 320, 457, 666, 682, 780
BspANI GGCC 5 cut(s) 9, 161, 278, 510, 778
BspCNI CTCAG 1 cut(s) 255
BspLI GGNNCC 4 cut(s) 10, 80, 167, 778
BspMI ACCTGC 1 cut(s) 248
BspT107I GGYRCC 1 cut(s) 78
BspTNI GGTCTC 1 cut(s) 838
BsrFI RCCGGY 1 cut(s) 384
BsrI ACTGG 1 cut(s) 106
BssAI RCCGGY 1 cut(s) 384
BssECI CCNNGG 1 cut(s) 477
BssNI GRCGYC 1 cut(s) 79
BssT1I CCWWGG 1 cut(s) 477
Bst2UI CCWGG 1 cut(s) 163
Bst4CI ACNGT 4 cut(s) 20, 115, 207, 378
Bst6I CTCTTC 2 cut(s) 39, 410
BstACI GRCGYC 1 cut(s) 79
BstC8I GCNNGC 2 cut(s) 390, 780
BstDEI CTNAG 1 cut(s) 242
BstF5I GGATG 3 cut(s) 83, 832, 857
BstH2I RGCGCY 1 cut(s) 82
BstHHI GCGC 2 cut(s) 81, 552
BstMAI GTCTC 3 cut(s) 97, 341, 838
BstMCI CGRYCG 1 cut(s) 19
BstMWI GCNNNNNNNGC 2 cut(s) 158, 516
BstNI CCWGG 1 cut(s) 163
BstSCI CCNGG 1 cut(s) 161
BstSLI GKGCMC 1 cut(s) 780
BstV1I GCAGC 4 cut(s) 62, 136, 820, 842
BstXI CCANNNNNNTGG 1 cut(s) 868
BsuRI GGCC 5 cut(s) 9, 161, 278, 510, 778
BtsCI GGATG 3 cut(s) 83, 832, 857
BtsIMutI CAGTG 2 cut(s) 250, 257
BveI ACCTGC 1 cut(s) 248
Cac8I GCNNGC 2 cut(s) 390, 780
CaiI CAGNNNCTG 1 cut(s) 263
CfoI GCGC 2 cut(s) 81, 552
Cfr10I RCCGGY 1 cut(s) 384
Cfr13I GGNCC 6 cut(s) 8, 104, 277, 508, 776, 777
Csp6I GTAC 1 cut(s) 657
CviAII CATG 5 cut(s) 365, 395, 412, 512, 572
CviQI GTAC 1 cut(s) 657
DdeI CTNAG 1 cut(s) 242
DinI GGCGCC 1 cut(s) 80
EaeI YGGCCR 1 cut(s) 159
Eam1104I CTCTTC 2 cut(s) 39, 410
EarI CTCTTC 2 cut(s) 39, 410
Eco130I CCWWGG 1 cut(s) 477
Eco24I GRGCYC 2 cut(s) 360, 780
Eco31I GGTCTC 1 cut(s) 838
Eco47I GGWCC 1 cut(s) 104
Eco57I CTGAAG 2 cut(s) 345, 717
EcoO109I RGGNCCY 1 cut(s) 776
EcoRII CCWGG 1 cut(s) 161
EcoT14I CCWWGG 1 cut(s) 477
EcoT38I GRGCYC 2 cut(s) 360, 780
EgeI GGCGCC 1 cut(s) 80
EheI GGCGCC 1 cut(s) 80
ErhI CCWWGG 1 cut(s) 477
Esp3I CGTCTC 1 cut(s) 97
FaeI CATG 5 cut(s) 368, 398, 415, 515, 575
FatI CATG 5 cut(s) 364, 394, 411, 511, 571
FauI CCCGC 3 cut(s) 63, 308, 787
FauNDI CATATG 1 cut(s) 74
Fnu4HI GCNGC 6 cut(s) 51, 150, 321, 457, 831, 834
FokI GGATG 3 cut(s) 70, 839, 844
FriOI GRGCYC 2 cut(s) 360, 780
Fsp4HI GCNGC 6 cut(s) 51, 150, 321, 457, 831, 834
FspBI CTAG 1 cut(s) 898
GlaI GCGC 2 cut(s) 80, 551
GluI GCNGC 6 cut(s) 51, 150, 321, 457, 831, 834
GsuI CTGGAG 1 cut(s) 48
HaeII RGCGCY 1 cut(s) 82
HaeIII GGCC 5 cut(s) 9, 161, 278, 510, 778
HapII CCGG 1 cut(s) 385
HhaI GCGC 2 cut(s) 81, 552
Hin1I GRCGYC 1 cut(s) 79
Hin1II CATG 5 cut(s) 368, 398, 415, 515, 575
Hin6I GCGC 2 cut(s) 79, 550
HinP1I GCGC 2 cut(s) 79, 550
HindIII AAGCTT 1 cut(s) 422
HinfI GANTC 6 cut(s) 122, 230, 311, 334, 440, 675
HpaII CCGG 1 cut(s) 385
HphI GGTGA 2 cut(s) 625, 680
Hpy188I TCNGA 7 cut(s) 16, 211, 445, 453, 706, 736, 843
Hpy188III TCNNGA 3 cut(s) 65, 629, 793
Hpy99I CGWCG 1 cut(s) 24
HpyAV CCTTC 7 cut(s) 69, 97, 179, 430, 741, 817, 874
HpyCH4III ACNGT 4 cut(s) 20, 115, 207, 378
HpyCH4V TGCA 5 cut(s) 257, 382, 830, 836, 852
HpyF10VI GCNNNNNNNGC 2 cut(s) 158, 516
HpyF3I CTNAG 1 cut(s) 242
Hsp92I GRCGYC 1 cut(s) 79
Hsp92II CATG 5 cut(s) 368, 398, 415, 515, 575
HspAI GCGC 2 cut(s) 79, 550
KasI GGCGCC 1 cut(s) 78
Lsp1109I GCAGC 4 cut(s) 62, 136, 820, 842
LweI GCATC 1 cut(s) 817
MaeI CTAG 1 cut(s) 898
MboII GAAGA 6 cut(s) 56, 145, 427, 465, 628, 811
MhlI GDGCHC 2 cut(s) 360, 780
MlsI TGGCCA 1 cut(s) 161
MluNI TGGCCA 1 cut(s) 161
Mly113I GGCGCC 1 cut(s) 79
MlyI GAGTC 1 cut(s) 343
MmeI TCCRAC 1 cut(s) 39
MnlI CCTC 9 cut(s) 22, 40, 117, 347, 411, 532, 549, 789, 813
Mox20I TGGCCA 1 cut(s) 161
MscI TGGCCA 1 cut(s) 161
MseI TTAA 1 cut(s) 225
MslI CAYNNNNRTG 1 cut(s) 399
Msp20I TGGCCA 1 cut(s) 161
MspA1I CMGCKG 1 cut(s) 833
MspI CCGG 1 cut(s) 385
MspR9I CCNGG 1 cut(s) 163
MvaI CCWGG 1 cut(s) 163
MwoI GCNNNNNNNGC 2 cut(s) 158, 516
NarI GGCGCC 1 cut(s) 79
NdeI CATATG 1 cut(s) 74
NlaIII CATG 5 cut(s) 368, 398, 415, 515, 575
NlaIV GGNNCC 4 cut(s) 10, 80, 167, 778
PfeI GAWTC 5 cut(s) 122, 230, 311, 440, 675
PkrI GCNGC 6 cut(s) 52, 151, 322, 458, 832, 835
PleI GAGTC 1 cut(s) 342
PluTI GGCGCC 1 cut(s) 82
PpsI GAGTC 1 cut(s) 342
PsiI TTATAA 1 cut(s) 690
Psp6I CCWGG 1 cut(s) 161
PspGI CCWGG 1 cut(s) 161
PspN4I GGNNCC 4 cut(s) 10, 80, 167, 778
PspOMI GGGCCC 1 cut(s) 776
PspPI GGNCC 6 cut(s) 8, 104, 277, 508, 776, 777
PstNI CAGNNNCTG 1 cut(s) 263
PvuII CAGCTG 1 cut(s) 833
RsaI GTAC 1 cut(s) 658
RsaNI GTAC 1 cut(s) 657
RseI CAYNNNNRTG 1 cut(s) 399
SaqAI TTAA 1 cut(s) 225
SatI GCNGC 6 cut(s) 51, 150, 321, 457, 831, 834
Sau96I GGNCC 6 cut(s) 8, 104, 277, 508, 776, 777
SchI GAGTC 1 cut(s) 343
ScrFI CCNGG 1 cut(s) 163
SduI GDGCHC 2 cut(s) 360, 780
SfaNI GCATC 1 cut(s) 817
SfoI GGCGCC 1 cut(s) 80
SinI GGWCC 1 cut(s) 104
SmiMI CAYNNNNRTG 1 cut(s) 399
SmlI CTYRAG 1 cut(s) 359
SmoI CTYRAG 1 cut(s) 359
SsiI CCGC 8 cut(s) 56, 152, 301, 320, 457, 666, 682, 780
SspDI GGCGCC 1 cut(s) 78
SspMI CTAG 1 cut(s) 898
StyD4I CCNGG 1 cut(s) 161
StyI CCWWGG 1 cut(s) 477
TaaI ACNGT 4 cut(s) 20, 115, 207, 378
TaqI TCGA 1 cut(s) 295
TauI GCSGC 2 cut(s) 323, 459
TfiI GAWTC 5 cut(s) 122, 230, 311, 440, 675
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TscAI CASTG 2 cut(s) 250, 257
TseI GCWGC 4 cut(s) 50, 149, 830, 833
TspDTI ATGAA 6 cut(s) 146, 428, 449, 588, 620, 846
TspGWI ACGGA 2 cut(s) 115, 551
TspRI CASTG 2 cut(s) 250, 257
VpaK11BI GGWCC 1 cut(s) 104
XcmI CCANNNNNNNNNTGG 1 cut(s) 72
XspI CTAG 1 cut(s) 898
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.