Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr11

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

20793495 .. 20802657

Gene Structure 9163 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD11G1175900.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 213 bp

ATGAAAAATGATATGACTTCTGCGGTGGTGGCCAGGAACCTTCTCACTCCCAAAGATAACAGACTACTTTCCAAACGGTCTGATGAGTTGGCTGTTAAGGATTCTCTGGCTATTCTATGGTTGAGATCAGCCATTGTGCTGGTTCTGTGTCTAATATGGCCCAACGCCTATTTGCTCGAACCCGCCAAGTTGAGTCATTGGGGGCTGAAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000724 GO:0000725 GO:0006139 GO:0006259 GO:0006281 GO:0006302 GO:0006310 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0009292 GO:0009294 GO:0009987 GO:0033554 GO:0034641 GO:0043170 GO:0044237 GO:0044238 GO:0044260 GO:0044764 GO:0045003 GO:0046483 GO:0050896 GO:0051704 GO:0051716 GO:0071704 GO:0090304 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HIRAN Helicase_C SNF2_N zf-C3HC4_2 zf-C3HC4_3

Protein Analysis

71

Amino Acids

7.91

Weight (kDa)

9.65

Isoelectric Point (pI)

44.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	23, 183
AcoI	YGGCCR	1 cut(s)	30
AjnI	CCWGG	1 cut(s)	32
AoxI	GGCC	2 cut(s)	30, 158
AspS9I	GGNCC	1 cut(s)	159
BalI	TGGCCA	1 cut(s)	32
BciT130I	CCWGG	1 cut(s)	34
Bme1390I	CCNGG	1 cut(s)	34
BmgT120I	GGNCC	1 cut(s)	159
BmiI	GGNNCC	1 cut(s)	38
BmrFI	CCNGG	1 cut(s)	34
BseBI	CCWGG	1 cut(s)	34
BshFI	GGCC	2 cut(s)	32, 160
BsnI	GGCC	2 cut(s)	32, 160
Bsp143I	GATC	1 cut(s)	125
BspACI	CCGC	2 cut(s)	23, 183
BspANI	GGCC	2 cut(s)	32, 160
BspLI	GGNNCC	1 cut(s)	38
BssMI	GATC	1 cut(s)	125
Bst2UI	CCWGG	1 cut(s)	34
Bst4CI	ACNGT	1 cut(s)	78
BstKTI	GATC	1 cut(s)	128
BstMBI	GATC	1 cut(s)	125
BstMWI	GCNNNNNNNGC	1 cut(s)	29
BstNI	CCWGG	1 cut(s)	34
BstSCI	CCNGG	1 cut(s)	32
BstXI	CCANNNNNNTGG	1 cut(s)	139
BsuRI	GGCC	2 cut(s)	32, 160
Cfr13I	GGNCC	1 cut(s)	159
CviJI	RGCY	6 cut(s)	32, 92, 110, 131, 160, 205
CviKI_1	RGCY	6 cut(s)	32, 92, 110, 131, 160, 205
DpnI	GATC	1 cut(s)	127
DpnII	GATC	1 cut(s)	125
EaeI	YGGCCR	1 cut(s)	30
EcoRII	CCWGG	1 cut(s)	32
FaiI	YATR	3 cut(s)	14, 118, 157
FauI	CCCGC	1 cut(s)	190
HaeIII	GGCC	2 cut(s)	32, 160
HinfI	GANTC	2 cut(s)	101, 193
Hpy188I	TCNGA	1 cut(s)	82
HpyAV	CCTTC	1 cut(s)	50
HpyCH4III	ACNGT	1 cut(s)	78
HpyF10VI	GCNNNNNNNGC	1 cut(s)	29
Kzo9I	GATC	1 cut(s)	125
LpnPI	CCDG	4 cut(s)	19, 46, 92, 125
MalI	GATC	1 cut(s)	127
MboI	GATC	1 cut(s)	125
MlsI	TGGCCA	1 cut(s)	32
MluNI	TGGCCA	1 cut(s)	32
MlyI	GAGTC	1 cut(s)	202
Mox20I	TGGCCA	1 cut(s)	32
MscI	TGGCCA	1 cut(s)	32
MseI	TTAA	1 cut(s)	96
Msp20I	TGGCCA	1 cut(s)	32
MspR9I	CCNGG	1 cut(s)	34
MvaI	CCWGG	1 cut(s)	34
MwoI	GCNNNNNNNGC	1 cut(s)	29
NdeII	GATC	1 cut(s)	125
NlaIV	GGNNCC	1 cut(s)	38
PfeI	GAWTC	1 cut(s)	101
PleI	GAGTC	1 cut(s)	201
PpsI	GAGTC	1 cut(s)	201
Psp6I	CCWGG	1 cut(s)	32
PspGI	CCWGG	1 cut(s)	32
PspN4I	GGNNCC	1 cut(s)	38
PspPI	GGNCC	1 cut(s)	159
SaqAI	TTAA	1 cut(s)	96
Sau3AI	GATC	1 cut(s)	125
Sau96I	GGNCC	1 cut(s)	159
SchI	GAGTC	1 cut(s)	202
ScrFI	CCNGG	1 cut(s)	34
SetI	ASST	1 cut(s)	42
SgeI	CNNG	7 cut(s)	45, 46, 119, 152, 188, 194, 199
SsiI	CCGC	2 cut(s)	23, 183
StyD4I	CCNGG	1 cut(s)	32
TaaI	ACNGT	1 cut(s)	78
TaqI	TCGA	1 cut(s)	177
TfiI	GAWTC	1 cut(s)	101
Tru1I	TTAA	1 cut(s)	96
Tru9I	TTAA	1 cut(s)	96
TspDTI	ATGAA	1 cut(s)	17

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.