Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00012596

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

213489 .. 214166

Gene Structure 678 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12596g00090.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 678 bp

ATGGCAAACCCATCGAACCTTAGCTTAGAATTGAGTCTCAGCAGTGATACGGCCGCGCCGCGTCAAGGTAACGTATGGCGCCCTTCTTTCTTATCTTCTAACGGTCCTCTCACAGGTGAAGACTCCGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTATCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTTAAACAGGAGATCAAACTGCTTAAGCATGAGAATAGAAGTTTGCACGTGCTTGCCAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAACTGCAAGAGTCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACCTTTTTCCTGGATCATCCAGCGTTTGGCCAAGTATTGAGGCTTCGAATGCTCTATCTTCGATGCCTCTATCTCCGATGCCTTCCGCTCCTATGTCTTCTGCCCCGATGCCTTCCGTCTCGATGCCTTCCGCTTCAAGAGTTTTGCCACGTAGTGGGTCTTTAAGTAAACAACCTTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

226

Amino Acids

24.38

Weight (kDa)

9.29

Isoelectric Point (pI)

68.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	78, 495
AccB7I	CCANNNNNTGG	2 cut(s)	522, 650
AccBSI	CCGCTC	2 cut(s)	297, 584
AccII	CGCG	2 cut(s)	56, 61
AciI	CCGC	5 cut(s)	54, 59, 295, 582, 627
AclWI	GGATC	1 cut(s)	517
AcoI	YGGCCR	3 cut(s)	51, 219, 524
AcuI	CTGAAG	1 cut(s)	465
AcvI	CACGTG	1 cut(s)	385
AcyI	GRCGYC	2 cut(s)	79, 138
AdeI	CACNNNGTG	2 cut(s)	245, 650
AfiI	CCNNNNNNNGG	5 cut(s)	65, 113, 307, 522, 650
AflII	CTTAAG	1 cut(s)	359
AgsI	TTSAA	3 cut(s)	227, 458, 633
AjnI	CCWGG	1 cut(s)	505
AluBI	AGCT	4 cut(s)	24, 149, 161, 424
AluI	AGCT	4 cut(s)	24, 149, 161, 424
Alw26I	GTCTC	2 cut(s)	41, 619
AlwI	GGATC	1 cut(s)	517
AoxI	GGCC	4 cut(s)	51, 219, 277, 524
ApeKI	GCWGC	1 cut(s)	193
ArsI	GACNNNNNNTTYG	2 cut(s)	451, 483
AspLEI	GCGC	2 cut(s)	58, 81
AspS9I	GGNCC	3 cut(s)	104, 207, 277
AsuHPI	GGTGA	1 cut(s)	128
AsuII	TTCGAA	1 cut(s)	542
AvaII	GGWCC	2 cut(s)	104, 207
BalI	TGGCCA	1 cut(s)	526
BanI	GGYRCC	2 cut(s)	78, 495
BarI	GAAGNNNNNNTAC	2 cut(s)	523, 555
BbrPI	CACGTG	1 cut(s)	385
BbsI	GAAGAC	2 cut(s)	126, 585
BbvI	GCAGC	1 cut(s)	180
BccI	CCATC	2 cut(s)	19, 313
BceAI	ACGGC	2 cut(s)	66, 206
BcgI	CGANNNNNNTGC	1 cut(s)	28
BciT130I	CCWGG	1 cut(s)	507
BciVI	GTATCC	1 cut(s)	277
BcoDI	GTCTC	2 cut(s)	41, 619
BfaI	CTAG	1 cut(s)	162
BfoI	RGCGCY	1 cut(s)	82
BfrI	CTTAAG	1 cut(s)	359
BfuI	GTATCC	1 cut(s)	277
BisI	GCNGC	3 cut(s)	54, 59, 194
BlsI	GCNGC	3 cut(s)	55, 60, 195
Bme1390I	CCNGG	1 cut(s)	507
Bme18I	GGWCC	2 cut(s)	104, 207
BmgT120I	GGNCC	3 cut(s)	104, 207, 277
BmiI	GGNNCC	3 cut(s)	80, 167, 497
BmrFI	CCNGG	1 cut(s)	507
BmsI	GCATC	5 cut(s)	120, 549, 564, 594, 609
BpiI	GAAGAC	2 cut(s)	126, 585
BpmI	CTGGAG	1 cut(s)	473
Bpu10I	CCTNAGC	1 cut(s)	20
Bpu14I	TTCGAA	1 cut(s)	542
BsaAI	YACGTR	2 cut(s)	385, 647
BsaHI	GRCGYC	2 cut(s)	79, 138
Bsc4I	CCNNNNNNNGG	5 cut(s)	65, 113, 307, 522, 650
BseBI	CCWGG	1 cut(s)	507
BseGI	GGATG	1 cut(s)	512
BseLI	CCNNNNNNNGG	5 cut(s)	65, 113, 307, 522, 650
BseMII	CTCAG	1 cut(s)	52
BseRI	GAGGAG	1 cut(s)	161
BseX3I	CGGCCG	1 cut(s)	51
BseXI	GCAGC	1 cut(s)	180
Bsh1236I	CGCG	2 cut(s)	56, 61
Bsh1285I	CGRYCG	1 cut(s)	54
BshFI	GGCC	4 cut(s)	53, 221, 279, 526
BshNI	GGYRCC	2 cut(s)	78, 495
BsiEI	CGRYCG	1 cut(s)	54
BslFI	GGGAC	1 cut(s)	217
BslI	CCNNNNNNNGG	5 cut(s)	65, 113, 307, 522, 650
BsmAI	GTCTC	2 cut(s)	41, 619
BsmBI	CGTCTC	1 cut(s)	619
BsmFI	GGGAC	1 cut(s)	217
BsmI	GAATGC	1 cut(s)	550
BsnI	GGCC	4 cut(s)	53, 221, 279, 526
Bsp119I	TTCGAA	1 cut(s)	542
Bsp143I	GATC	2 cut(s)	348, 509
BspACI	CCGC	5 cut(s)	54, 59, 295, 582, 627
BspANI	GGCC	4 cut(s)	53, 221, 279, 526
BspCNI	CTCAG	1 cut(s)	51
BspFNI	CGCG	2 cut(s)	56, 61
BspLI	GGNNCC	3 cut(s)	80, 167, 497
BspPI	GGATC	1 cut(s)	517
BspT104I	TTCGAA	1 cut(s)	542
BspT107I	GGYRCC	2 cut(s)	78, 495
BspTI	CTTAAG	1 cut(s)	359
BsrBI	CCGCTC	2 cut(s)	297, 584
BssMI	GATC	2 cut(s)	348, 509
BssNI	GRCGYC	2 cut(s)	79, 138
Bst2UI	CCWGG	1 cut(s)	507
Bst4CI	ACNGT	3 cut(s)	104, 207, 467
Bst6I	CTCTTC	1 cut(s)	410
BstACI	GRCGYC	2 cut(s)	79, 138
BstAFI	CTTAAG	1 cut(s)	359
BstBAI	YACGTR	2 cut(s)	385, 647
BstBI	TTCGAA	1 cut(s)	542
BstC8I	GCNNGC	4 cut(s)	287, 291, 295, 390
BstDEI	CTNAG	4 cut(s)	20, 25, 38, 242
BstENI	CCTNNNNNAGG	1 cut(s)	111
BstF5I	GGATG	1 cut(s)	512
BstFNI	CGCG	2 cut(s)	56, 61
BstH2I	RGCGCY	1 cut(s)	82
BstHHI	GCGC	2 cut(s)	58, 81
BstKTI	GATC	2 cut(s)	351, 512
BstMAI	GTCTC	2 cut(s)	41, 619
BstMBI	GATC	2 cut(s)	348, 509
BstMCI	CGRYCG	1 cut(s)	54
BstMWI	GCNNNNNNNGC	2 cut(s)	146, 545
BstNI	CCWGG	1 cut(s)	507
BstSCI	CCNGG	1 cut(s)	505
BstUI	CGCG	2 cut(s)	56, 61
BstV1I	GCAGC	1 cut(s)	180
BstV2I	GAAGAC	2 cut(s)	126, 585
BstZI	CGGCCG	1 cut(s)	51
BsuI	GTATCC	1 cut(s)	277
BsuRI	GGCC	4 cut(s)	53, 221, 279, 526
BtsCI	GGATG	1 cut(s)	512
BtsI	GCAGTG	1 cut(s)	49
BtsIMutI	CAGTG	2 cut(s)	49, 257
Cac8I	GCNNGC	4 cut(s)	287, 291, 295, 390
CfoI	GCGC	2 cut(s)	58, 81
Cfr13I	GGNCC	3 cut(s)	104, 207, 277
CpoI	CGGWCCG	1 cut(s)	207
CseI	GACGC	2 cut(s)	50, 146
CspI	CGGWCCG	1 cut(s)	207
CviAII	CATG	3 cut(s)	274, 365, 412
DdeI	CTNAG	4 cut(s)	20, 25, 38, 242
DinI	GGCGCC	1 cut(s)	80
DpnI	GATC	2 cut(s)	350, 511
DpnII	GATC	2 cut(s)	348, 509
DraIII	CACNNNGTG	2 cut(s)	245, 650
EaeI	YGGCCR	3 cut(s)	51, 219, 524
EagI	CGGCCG	1 cut(s)	51
Eam1104I	CTCTTC	1 cut(s)	410
EarI	CTCTTC	1 cut(s)	410
EclXI	CGGCCG	1 cut(s)	51
Eco47I	GGWCC	2 cut(s)	104, 207
Eco52I	CGGCCG	1 cut(s)	51
Eco57I	CTGAAG	1 cut(s)	465
Eco72I	CACGTG	1 cut(s)	385
EcoNI	CCTNNNNNAGG	1 cut(s)	111
EcoRII	CCWGG	1 cut(s)	505
EgeI	GGCGCC	1 cut(s)	80
EheI	GGCGCC	1 cut(s)	80
Esp3I	CGTCTC	1 cut(s)	619
FaeI	CATG	3 cut(s)	277, 368, 415
FaiI	YATR	5 cut(s)	76, 275, 366, 413, 590
FaqI	GGGAC	1 cut(s)	217
FatI	CATG	3 cut(s)	273, 364, 411
FauI	CCCGC	1 cut(s)	302
Fnu4HI	GCNGC	3 cut(s)	54, 59, 194
FokI	GGATG	1 cut(s)	499
Fsp4HI	GCNGC	3 cut(s)	54, 59, 194
FspBI	CTAG	1 cut(s)	162
GlaI	GCGC	2 cut(s)	57, 80
GluI	GCNGC	3 cut(s)	54, 59, 194
GsuI	CTGGAG	1 cut(s)	473
HaeII	RGCGCY	1 cut(s)	82
HaeIII	GGCC	4 cut(s)	53, 221, 279, 526
HgaI	GACGC	2 cut(s)	50, 146
HhaI	GCGC	2 cut(s)	58, 81
Hin1I	GRCGYC	2 cut(s)	79, 138
Hin1II	CATG	3 cut(s)	277, 368, 415
Hin6I	GCGC	2 cut(s)	56, 79
HinP1I	GCGC	2 cut(s)	56, 79
HindIII	AAGCTT	1 cut(s)	422
HinfI	GANTC	6 cut(s)	34, 122, 230, 311, 440, 454
HphI	GGTGA	1 cut(s)	128
Hpy166II	GTNNAC	1 cut(s)	665
Hpy188I	TCNGA	4 cut(s)	211, 445, 453, 573
Hpy188III	TCNNGA	5 cut(s)	201, 227, 490, 616, 633
Hpy8I	GTNNAC	1 cut(s)	665
Hpy99I	CGWCG	1 cut(s)	409
HpyAV	CCTTC	5 cut(s)	93, 440, 588, 618, 633
HpyCH4III	ACNGT	3 cut(s)	104, 207, 467
HpyCH4IV	ACGT	3 cut(s)	72, 384, 646
HpyCH4V	TGCA	3 cut(s)	133, 382, 436
HpyF10VI	GCNNNNNNNGC	2 cut(s)	146, 545
HpyF3I	CTNAG	4 cut(s)	20, 25, 38, 242
HpySE526I	ACGT	3 cut(s)	72, 384, 646
Hsp92I	GRCGYC	2 cut(s)	79, 138
Hsp92II	CATG	3 cut(s)	277, 368, 415
HspAI	GCGC	2 cut(s)	56, 79
KasI	GGCGCC	1 cut(s)	78
Kzo9I	GATC	2 cut(s)	348, 509
LmnI	GCTCC	2 cut(s)	302, 589
Lsp1109I	GCAGC	1 cut(s)	180
LweI	GCATC	5 cut(s)	120, 549, 564, 594, 609
MaeI	CTAG	1 cut(s)	162
MaeII	ACGT	3 cut(s)	72, 384, 646
MaeIII	GTNAC	2 cut(s)	68, 461
MalI	GATC	2 cut(s)	350, 511
MbiI	CCGCTC	2 cut(s)	297, 584
MboI	GATC	2 cut(s)	348, 509
MboII	GAAGA	5 cut(s)	87, 131, 427, 546, 585
MlsI	TGGCCA	1 cut(s)	526
MluCI	AATT	1 cut(s)	29
MluNI	TGGCCA	1 cut(s)	526
Mly113I	GGCGCC	1 cut(s)	79
MlyI	GAGTC	4 cut(s)	43, 116, 239, 449
MmeI	TCCRAC	2 cut(s)	294, 431
Mox20I	TGGCCA	1 cut(s)	526
MscI	TGGCCA	1 cut(s)	526
MseI	TTAA	3 cut(s)	339, 360, 659
Msp20I	TGGCCA	1 cut(s)	526
MspCI	CTTAAG	1 cut(s)	359
MspR9I	CCNGG	1 cut(s)	507
Mva1269I	GAATGC	1 cut(s)	550
MvaI	CCWGG	1 cut(s)	507
MvnI	CGCG	2 cut(s)	56, 61
MwoI	GCNNNNNNNGC	2 cut(s)	146, 545
NarI	GGCGCC	1 cut(s)	79
NdeII	GATC	2 cut(s)	348, 509
NlaIII	CATG	3 cut(s)	277, 368, 415
NlaIV	GGNNCC	3 cut(s)	80, 167, 497
NmuCI	GTSAC	1 cut(s)	461
NspV	TTCGAA	1 cut(s)	542
PctI	GAATGC	1 cut(s)	550
PfeI	GAWTC	2 cut(s)	311, 454
PflMI	CCANNNNNTGG	2 cut(s)	522, 650
PfoI	TCCNGGA	1 cut(s)	505
PkrI	GCNGC	3 cut(s)	55, 60, 195
PleI	GAGTC	4 cut(s)	42, 116, 238, 448
PluTI	GGCGCC	1 cut(s)	82
PmaCI	CACGTG	1 cut(s)	385
PmlI	CACGTG	1 cut(s)	385
PpsI	GAGTC	4 cut(s)	42, 116, 238, 448
Ppu21I	YACGTR	2 cut(s)	385, 647
Psp6I	CCWGG	1 cut(s)	505
PspCI	CACGTG	1 cut(s)	385
PspGI	CCWGG	1 cut(s)	505
PspN4I	GGNNCC	3 cut(s)	80, 167, 497
PspPI	GGNCC	3 cut(s)	104, 207, 277
Rsr2I	CGGWCCG	1 cut(s)	207
RsrII	CGGWCCG	1 cut(s)	207
SaqAI	TTAA	3 cut(s)	339, 360, 659
SatI	GCNGC	3 cut(s)	54, 59, 194
Sau3AI	GATC	2 cut(s)	348, 509
Sau96I	GGNCC	3 cut(s)	104, 207, 277
SchI	GAGTC	4 cut(s)	43, 116, 239, 449
ScrFI	CCNGG	1 cut(s)	507
SfaNI	GCATC	5 cut(s)	120, 549, 564, 594, 609
SfoI	GGCGCC	1 cut(s)	80
SfuI	TTCGAA	1 cut(s)	542
SinI	GGWCC	2 cut(s)	104, 207
SmlI	CTYRAG	1 cut(s)	359
SmoI	CTYRAG	1 cut(s)	359
Sse9I	AATT	1 cut(s)	29
SsiI	CCGC	5 cut(s)	54, 59, 295, 582, 627
SspDI	GGCGCC	1 cut(s)	78
SspMI	CTAG	1 cut(s)	162
StyD4I	CCNGG	1 cut(s)	505
TaaI	ACNGT	3 cut(s)	104, 207, 467
TaiI	ACGT	3 cut(s)	75, 387, 649
TaqI	TCGA	5 cut(s)	14, 404, 542, 557, 617
TasI	AATT	1 cut(s)	29
TauI	GCSGC	2 cut(s)	56, 61
TfiI	GAWTC	2 cut(s)	311, 454
Tru1I	TTAA	3 cut(s)	339, 360, 659
Tru9I	TTAA	3 cut(s)	339, 360, 659
TscAI	CASTG	2 cut(s)	49, 257
TseFI	GTSAC	1 cut(s)	461
TseI	GCWGC	1 cut(s)	193
Tsp45I	GTSAC	1 cut(s)	461
TspDTI	ATGAA	2 cut(s)	428, 444
TspGWI	ACGGA	2 cut(s)	115, 601
TspRI	CASTG	2 cut(s)	49, 257
Van91I	CCANNNNNTGG	2 cut(s)	522, 650
Vha464I	CTTAAG	1 cut(s)	359
VpaK11BI	GGWCC	2 cut(s)	104, 207
XagI	CCTNNNNNAGG	1 cut(s)	111
XspI	CTAG	1 cut(s)	162

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.