pycom12g09550

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0000120
Physical Location & Seq
Forward (+)
11483588 .. 11484602
1015 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g09550.3

Sequence Viewer

Length: 660 bp
ATGAGCGGTTTCAGGATTCAAACATATGGCAGGCAAGCACAAGGTGGAGGTATGACCTGTTTCTTTCAGCATGTGCAGTTGTTGCGTTTGCCAATGATCAACAAGATTGATGTTTCATTGTCACTCGTCCTAGCTGTTCTCCAAGTGAATGTGGTATATTCTCTGGAAGTAAGCAACCAGGGAATAGATTCCAGGCAGTCGGTTCCAGATCGAAAGACTGATTCCAAGTGCCGGCTGATTGCTTACTTTCTCTTTGGCCTAAGTATTGACGATTTAACGGCGTCGCGTGGCGAGGCTTTGCTCTTTGGCGACGGCGCCAGCAGAGGGTTGTTGAGGCTTCTTGGATGGTTCTGCAGGGGAAGGCGTCGTGCTCCAGCAGTTTATTCCAGCTCCTTGTACCGCATTCTTCTCTGCTTGTTTCTTTTACATAGCCGAGGTGGTGCGCAACCCTTTGCCTTTAAATGGTCTTTCAGGGCATCACTTCTCAGCAATTCATCTATGCTTGGCAGCTTCAGTGTAAAGAGCCGACACTCCGTCACCTGTCCGGAAGTATGTGCTGAGGGAATTCAAGACTCACCAACAGTTGAAGATGAGCACTCGAGAGCAACACTAGATACCTTTGCTTTCGCCCTTGATGATATGAGATACTTTTGCTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

220

Amino Acids

24.42

Weight (kDa)

9.08

Isoelectric Point (pI)

41.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 444
AccB1I GGYRCC 1 cut(s) 314
AccBSI CCGCTC 1 cut(s) 6
AccII CGCG 1 cut(s) 286
AccIII TCCGGA 1 cut(s) 544
AciI CCGC 2 cut(s) 6, 400
AcsI RAATTY 1 cut(s) 564
AcuI CTGAAG 1 cut(s) 496
AcyI GRCGYC 3 cut(s) 281, 315, 364
AdeI CACNNNGTG 1 cut(s) 44
AfaI GTAC 1 cut(s) 398
AfiI CCNNNNNNNGG 3 cut(s) 231, 324, 462
AgsI TTSAA 3 cut(s) 20, 569, 587
AhdI GACNNNNNGTC 1 cut(s) 533
AjnI CCWGG 2 cut(s) 177, 191
AluBI AGCT 3 cut(s) 134, 390, 510
AluI AGCT 3 cut(s) 134, 390, 510
Alw21I GWGCWC 2 cut(s) 373, 597
Ama87I CYCGRG 1 cut(s) 598
Aor13HI TCCGGA 1 cut(s) 544
AoxI GGCC 1 cut(s) 256
ApeKI GCWGC 1 cut(s) 507
ApoI RAATTY 1 cut(s) 564
Asp700I GAANNNNTTC 1 cut(s) 187
AspLEI GCGC 2 cut(s) 317, 445
AsuHPI GGTGA 2 cut(s) 529, 567
AvaI CYCGRG 1 cut(s) 598
BanI GGYRCC 1 cut(s) 314
Bbv12I GWGCWC 2 cut(s) 373, 597
BbvCI CCTCAGC 1 cut(s) 558
BbvI GCAGC 1 cut(s) 519
BccI CCATC 1 cut(s) 339
BceAI ACGGC 2 cut(s) 294, 328
BciT130I CCWGG 2 cut(s) 179, 193
BclI TGATCA 1 cut(s) 96
BfaI CTAG 2 cut(s) 131, 611
BfmI CTRYAG 1 cut(s) 352
BfoI RGCGCY 1 cut(s) 318
BisI GCNGC 1 cut(s) 508
BlsI GCNGC 1 cut(s) 509
Bme1390I CCNGG 2 cut(s) 179, 193
BmeRI GACNNNNNGTC 1 cut(s) 533
BmeT110I CYCGRG 1 cut(s) 598
BmiI GGNNCC 2 cut(s) 204, 316
BmrFI CCNGG 2 cut(s) 179, 193
BmsI GCATC 1 cut(s) 485
BpmI CTGGAG 1 cut(s) 357
Bpu10I CCTNAGC 1 cut(s) 558
BsaHI GRCGYC 3 cut(s) 281, 315, 364
BsaJI CCNNGG 2 cut(s) 178, 433
BsaWI WCCGGW 1 cut(s) 544
Bsc4I CCNNNNNNNGG 3 cut(s) 231, 324, 462
Bse118I RCCGGY 1 cut(s) 231
BseAI TCCGGA 1 cut(s) 544
BseBI CCWGG 2 cut(s) 179, 193
BseDI CCNNGG 2 cut(s) 178, 433
BseGI GGATG 1 cut(s) 350
BseLI CCNNNNNNNGG 3 cut(s) 231, 324, 462
BseMII CTCAG 2 cut(s) 499, 549
BseXI GCAGC 1 cut(s) 519
BsgI GTGCAG 1 cut(s) 95
Bsh1236I CGCG 1 cut(s) 286
BshFI GGCC 1 cut(s) 258
BshNI GGYRCC 1 cut(s) 314
BsiHKAI GWGCWC 2 cut(s) 373, 597
BsiHKCI CYCGRG 1 cut(s) 598
BsiSI CCGG 2 cut(s) 232, 545
BslI CCNNNNNNNGG 3 cut(s) 231, 324, 462
BsmI GAATGC 1 cut(s) 402
BsnI GGCC 1 cut(s) 258
BsoBI CYCGRG 1 cut(s) 598
Bsp1286I GDGCHC 2 cut(s) 373, 597
Bsp13I TCCGGA 1 cut(s) 544
Bsp143I GATC 2 cut(s) 96, 208
BspACI CCGC 2 cut(s) 6, 400
BspANI GGCC 1 cut(s) 258
BspCNI CTCAG 2 cut(s) 498, 550
BspEI TCCGGA 1 cut(s) 544
BspFNI CGCG 1 cut(s) 286
BspLI GGNNCC 2 cut(s) 204, 316
BspMAI CTGCAG 1 cut(s) 356
BspT107I GGYRCC 1 cut(s) 314
BsrBI CCGCTC 1 cut(s) 6
BsrFI RCCGGY 1 cut(s) 231
BssAI RCCGGY 1 cut(s) 231
BssECI CCNNGG 2 cut(s) 178, 433
BssMI GATC 2 cut(s) 96, 208
BssNI GRCGYC 3 cut(s) 281, 315, 364
Bst2UI CCWGG 2 cut(s) 179, 193
Bst4CI ACNGT 1 cut(s) 583
BstACI GRCGYC 3 cut(s) 281, 315, 364
BstAPI GCANNNNNTGC 1 cut(s) 82
BstC8I GCNNGC 4 cut(s) 32, 36, 233, 319
BstDEI CTNAG 3 cut(s) 260, 485, 558
BstF5I GGATG 1 cut(s) 350
BstFNI CGCG 1 cut(s) 286
BstH2I RGCGCY 1 cut(s) 318
BstHHI GCGC 2 cut(s) 317, 445
BstKTI GATC 2 cut(s) 99, 211
BstMBI GATC 2 cut(s) 96, 208
BstMWI GCNNNNNNNGC 1 cut(s) 82
BstNI CCWGG 2 cut(s) 179, 193
BstNSI RCATGY 1 cut(s) 74
BstSCI CCNGG 2 cut(s) 177, 191
BstSFI CTRYAG 1 cut(s) 352
BstUI CGCG 1 cut(s) 286
BstV1I GCAGC 1 cut(s) 519
BsuRI GGCC 1 cut(s) 258
BtsCI GGATG 1 cut(s) 350
BtsIMutI CAGTG 1 cut(s) 520
Cac8I GCNNGC 4 cut(s) 32, 36, 233, 319
CfoI GCGC 2 cut(s) 317, 445
Cfr10I RCCGGY 1 cut(s) 231
CseI GACGC 2 cut(s) 270, 353
Csp6I GTAC 1 cut(s) 397
CviAII CATG 1 cut(s) 71
CviJI RGCY 9 cut(s) 134, 235, 258, 296, 337, 390, 432, 510, 525
CviKI_1 RGCY 9 cut(s) 134, 235, 258, 296, 337, 390, 432, 510, 525
CviQI GTAC 1 cut(s) 397
DdeI CTNAG 3 cut(s) 260, 485, 558
DinI GGCGCC 1 cut(s) 316
DpnI GATC 2 cut(s) 98, 210
DpnII GATC 2 cut(s) 96, 208
DraI TTTAAA 1 cut(s) 460
DraIII CACNNNGTG 1 cut(s) 44
DriI GACNNNNNGTC 1 cut(s) 533
Eam1105I GACNNNNNGTC 1 cut(s) 533
Eco57I CTGAAG 1 cut(s) 496
Eco88I CYCGRG 1 cut(s) 598
EcoRI GAATTC 1 cut(s) 564
EcoRII CCWGG 2 cut(s) 177, 191
EgeI GGCGCC 1 cut(s) 316
EheI GGCGCC 1 cut(s) 316
FaeI CATG 1 cut(s) 74
FaiI YATR 9 cut(s) 25, 27, 53, 72, 157, 429, 500, 553, 641
FatI CATG 1 cut(s) 70
FauNDI CATATG 1 cut(s) 25
FbaI TGATCA 1 cut(s) 96
Fnu4HI GCNGC 1 cut(s) 508
FokI GGATG 1 cut(s) 357
Fsp4HI GCNGC 1 cut(s) 508
FspBI CTAG 2 cut(s) 131, 611
FspI TGCGCA 1 cut(s) 444
GlaI GCGC 2 cut(s) 316, 444
GluI GCNGC 1 cut(s) 508
GsuI CTGGAG 1 cut(s) 357
HaeII RGCGCY 1 cut(s) 318
HaeIII GGCC 1 cut(s) 258
HapII CCGG 2 cut(s) 232, 545
HgaI GACGC 2 cut(s) 270, 353
HhaI GCGC 2 cut(s) 317, 445
Hin1I GRCGYC 3 cut(s) 281, 315, 364
Hin1II CATG 1 cut(s) 74
Hin6I GCGC 2 cut(s) 315, 443
HinP1I GCGC 2 cut(s) 315, 443
HinfI GANTC 4 cut(s) 16, 188, 221, 572
HpaII CCGG 2 cut(s) 232, 545
HphI GGTGA 2 cut(s) 529, 567
Hpy188III TCNNGA 6 cut(s) 13, 164, 206, 545, 569, 600
Hpy99I CGWCG 3 cut(s) 286, 314, 369
HpyAV CCTTC 1 cut(s) 354
HpyCH4III ACNGT 1 cut(s) 583
HpyCH4V TGCA 2 cut(s) 76, 354
HpyF10VI GCNNNNNNNGC 1 cut(s) 82
HpyF3I CTNAG 3 cut(s) 260, 485, 558
Hsp92I GRCGYC 3 cut(s) 281, 315, 364
Hsp92II CATG 1 cut(s) 74
HspAI GCGC 2 cut(s) 315, 443
KasI GGCGCC 1 cut(s) 314
Kpn2I TCCGGA 1 cut(s) 544
KroI GCCGGC 1 cut(s) 231
KroNI GCCGGC 1 cut(s) 233
Ksp22I TGATCA 1 cut(s) 96
Kzo9I GATC 2 cut(s) 96, 208
LmnI GCTCC 2 cut(s) 376, 395
Lsp1109I GCAGC 1 cut(s) 519
LweI GCATC 1 cut(s) 485
MaeI CTAG 2 cut(s) 131, 611
MaeIII GTNAC 2 cut(s) 120, 535
MalI GATC 2 cut(s) 98, 210
MbiI CCGCTC 1 cut(s) 6
MboI GATC 2 cut(s) 96, 208
MboII GAAGA 2 cut(s) 398, 599
MhlI GDGCHC 2 cut(s) 373, 597
MluCI AATT 2 cut(s) 490, 564
Mly113I GGCGCC 1 cut(s) 315
MlyI GAGTC 1 cut(s) 566
MnlI CCTC 6 cut(s) 41, 286, 317, 327, 428, 553
MroI TCCGGA 1 cut(s) 544
MroNI GCCGGC 1 cut(s) 231
MroXI GAANNNNTTC 1 cut(s) 187
MseI TTAA 2 cut(s) 275, 459
MspI CCGG 2 cut(s) 232, 545
MspR9I CCNGG 2 cut(s) 179, 193
Mva1269I GAATGC 1 cut(s) 402
MvaI CCWGG 2 cut(s) 179, 193
MvnI CGCG 1 cut(s) 286
MwoI GCNNNNNNNGC 1 cut(s) 82
NaeI GCCGGC 1 cut(s) 233
NarI GGCGCC 1 cut(s) 315
NdeI CATATG 1 cut(s) 25
NdeII GATC 2 cut(s) 96, 208
NgoMIV GCCGGC 1 cut(s) 231
NlaIII CATG 1 cut(s) 74
NlaIV GGNNCC 2 cut(s) 204, 316
NmeAIII GCCGAG 1 cut(s) 458
NmuCI GTSAC 2 cut(s) 120, 535
NsbI TGCGCA 1 cut(s) 444
NspI RCATGY 1 cut(s) 74
PaeR7I CTCGAG 1 cut(s) 598
PctI GAATGC 1 cut(s) 402
PdiI GCCGGC 1 cut(s) 233
PdmI GAANNNNTTC 1 cut(s) 187
PfeI GAWTC 3 cut(s) 16, 188, 221
PkrI GCNGC 1 cut(s) 509
PleI GAGTC 1 cut(s) 566
PluTI GGCGCC 1 cut(s) 318
PpsI GAGTC 1 cut(s) 566
Psp6I CCWGG 2 cut(s) 177, 191
PspGI CCWGG 2 cut(s) 177, 191
PspN4I GGNNCC 2 cut(s) 204, 316
PstI CTGCAG 1 cut(s) 356
RsaI GTAC 1 cut(s) 398
RsaNI GTAC 1 cut(s) 397
SaqAI TTAA 2 cut(s) 275, 459
SatI GCNGC 1 cut(s) 508
Sau3AI GATC 2 cut(s) 96, 208
SchI GAGTC 1 cut(s) 566
ScrFI CCNGG 2 cut(s) 179, 193
SduI GDGCHC 2 cut(s) 373, 597
SetI ASST 9 cut(s) 46, 52, 59, 136, 392, 439, 512, 542, 620
SfaNI GCATC 1 cut(s) 485
SfcI CTRYAG 1 cut(s) 352
SfoI GGCGCC 1 cut(s) 316
Sfr274I CTCGAG 1 cut(s) 598
SlaI CTCGAG 1 cut(s) 598
SmlI CTYRAG 1 cut(s) 598
SmoI CTYRAG 1 cut(s) 598
Sse9I AATT 2 cut(s) 490, 564
SsiI CCGC 2 cut(s) 6, 400
SspDI GGCGCC 1 cut(s) 314
SspMI CTAG 2 cut(s) 131, 611
StyD4I CCNGG 2 cut(s) 177, 191
TaaI ACNGT 1 cut(s) 583
TaqI TCGA 2 cut(s) 211, 599
TasI AATT 2 cut(s) 490, 564
TfiI GAWTC 3 cut(s) 16, 188, 221
Tru1I TTAA 2 cut(s) 275, 459
Tru9I TTAA 2 cut(s) 275, 459
TscAI CASTG 1 cut(s) 520
TseFI GTSAC 2 cut(s) 120, 535
TseI GCWGC 1 cut(s) 507
Tsp45I GTSAC 2 cut(s) 120, 535
TspDTI ATGAA 2 cut(s) 105, 483
TspGWI ACGGA 1 cut(s) 523
TspRI CASTG 1 cut(s) 520
XapI RAATTY 1 cut(s) 564
XceI RCATGY 1 cut(s) 74
XhoI CTCGAG 1 cut(s) 598
XmnI GAANNNNTTC 1 cut(s) 187
XspI CTAG 2 cut(s) 131, 611
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.