pycom436g00410

Chloroplast-localized elongation factor EF-G involved in protein synthesis in plastids. Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A- site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_436
Physical Location & Seq
Forward (+)
471054 .. 479609
8556 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom436g00410.1

Sequence Viewer

Length: 1188 bp
ATGAATGCAAGGGTATTTATAGGATGTATCTCTATTATGATGACATGTAGGGAACTTTTGAGAATGTTTTGGGTTGTCACGGTTAATTTGGGGCATTGTCATGAGGACAAAGCTATCACTTTGGGAAGTGCTATGGAGGTTGGAGCTGACCTAAAAATGTCCAAACATAGCCTAGAAGTGGATGAAGAGCTGCTAATTGAGGAGGAGGAAGAAGACATGCACACGGCAAGGGTAGAACAACCCTTGCCGCAGCCCCCTAAGCCCTCTAAACCACCCACCACCAGTAAGGACGTCCCAATTCCATGTTATTCTGATGTTATTCCACCCAATGTCCCTTTTCCTAGCAGGTTTTTGATTCCCAACCAAGAAGAGAGTAAAAAGGACATCGTGGAAGCCTTCCCAAAGGAGCAAAATGCTATTCAAATTCTTGGTGCAACACAAAGAATGATTCAAGAGAAGGTAGTGGCTGGAGAAGATGTAGAAGGCATCAAAGAGGACATATTTGAAACCACAATTCCCAAGGAAGTTGGATTTTATGACACGGGACAAGTCATAACTTTCGACGGGGTGTTTATTCTGGAGTTCATTTTGGAGCACACAGGTAAGCCGCCTCCCCGAATTTCAATTTTCTTTTATACTAACATGTGGTTAATGATCCAGGCACCCACTTTAGAATTTGAACCAATGCCGGTTCACTTCAAGTATCACCTTCCATTCAAGGACCAATTCCATATGCCTGGAATACATATGACCCAGGAGGAAACGCAAAGGTATCTCATATCATCAAGGTCAAAAGCAAAAATATCTCATATCATGCTCTTTCCCTGTCTTTTTCTTTGTCCTTGTTCTTACTTGCATGGCAAAGTAAAAGAAGCAATCAGCCGGCACTTGGAGTCAGTCTACCGATCTGGAGCCAACTGCCCGGAATCTATTCCTGATTGCTTACCTAGCGTTGATAAGGATTTGGTTTATAATTGCATGACGGTTAGAAAGAGTTATAAACATAGAGAAAAGTTTGATTTACTCTTGGTATATAAAAGAAAAATTCGTTTTTGTAACATGCTTGAAGGAAGAAACTCAAACAAACGCTACATCCCTGTGAGACTCGAGCCATTACTTTCTTTGGAGAGGAAGAGAAGAGTGCCTAAACGTTCATACAATTCAAGTTTGAGTTGTTGGAATGTTTAG

Protein Analysis

396

Amino Acids

45.65

Weight (kDa)

6.89

Isoelectric Point (pI)

52.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 972, 999
AatII GACGTC 1 cut(s) 294
Acc36I ACCTGC 1 cut(s) 336
AccB1I GGYRCC 1 cut(s) 661
AccI GTMKAC 1 cut(s) 900
AciI CCGC 2 cut(s) 248, 608
AclI AACGTT 1 cut(s) 1150
AclWI GGATC 1 cut(s) 649
AcsI RAATTY 4 cut(s) 423, 618, 674, 1044
AcyI GRCGYC 1 cut(s) 291
AfiI CCNNNNNNNGG 2 cut(s) 178, 889
AflIII ACRYGT 2 cut(s) 44, 642
AgsI TTSAA 9 cut(s) 422, 452, 506, 624, 680, 700, 718, 1067, 1164
AjnI CCWGG 3 cut(s) 657, 736, 753
AluBI AGCT 3 cut(s) 113, 146, 190
AluI AGCT 3 cut(s) 113, 146, 190
Alw21I GWGCWC 1 cut(s) 597
Alw26I GTCTC 1 cut(s) 1096
AlwI GGATC 1 cut(s) 649
Ama87I CYCGRG 1 cut(s) 1106
ApeKI GCWGC 2 cut(s) 190, 250
ApoI RAATTY 4 cut(s) 423, 618, 674, 1044
Asp700I GAANNNNTTC 1 cut(s) 930
AspS9I GGNCC 1 cut(s) 721
AsuC2I CCSGG 1 cut(s) 923
AsuHPI GGTGA 1 cut(s) 698
AvaI CYCGRG 1 cut(s) 1106
AvaII GGWCC 1 cut(s) 721
BanI GGYRCC 1 cut(s) 661
BbsI GAAGAC 1 cut(s) 219
Bbv12I GWGCWC 1 cut(s) 597
BbvI GCAGC 2 cut(s) 177, 262
BceAI ACGGC 1 cut(s) 240
BciT130I CCWGG 3 cut(s) 659, 738, 755
BcnI CCSGG 1 cut(s) 923
BcoDI GTCTC 1 cut(s) 1096
BfaI CTAG 3 cut(s) 173, 342, 948
BfuAI ACCTGC 1 cut(s) 336
BisI GCNGC 4 cut(s) 191, 248, 251, 608
BlsI GCNGC 4 cut(s) 192, 249, 252, 609
Bme1390I CCNGG 4 cut(s) 659, 738, 755, 923
Bme18I GGWCC 1 cut(s) 721
BmeT110I CYCGRG 1 cut(s) 1106
BmgT120I GGNCC 1 cut(s) 721
BmiI GGNNCC 2 cut(s) 663, 913
BmrFI CCNGG 4 cut(s) 659, 738, 755, 923
BmsI GCATC 1 cut(s) 495
BpiI GAAGAC 1 cut(s) 219
BpmI CTGGAG 3 cut(s) 489, 599, 930
Bpu10I CCTNAGC 1 cut(s) 258
BpuMI CCSGG 1 cut(s) 923
BsaHI GRCGYC 1 cut(s) 291
BsaJI CCNNGG 2 cut(s) 519, 753
BsaXI ACNNNNNCTCC 2 cut(s) 462, 492
Bsc4I CCNNNNNNNGG 2 cut(s) 178, 889
Bse118I RCCGGY 2 cut(s) 688, 882
Bse1I ACTGG 1 cut(s) 282
BseBI CCWGG 3 cut(s) 659, 738, 755
BseDI CCNNGG 2 cut(s) 519, 753
BseGI GGATG 3 cut(s) 29, 187, 1092
BseLI CCNNNNNNNGG 2 cut(s) 178, 889
BseNI ACTGG 1 cut(s) 282
BseRI GAGGAG 2 cut(s) 215, 218
BseXI GCAGC 2 cut(s) 177, 262
BshNI GGYRCC 1 cut(s) 661
BsiHKAI GWGCWC 1 cut(s) 597
BsiHKCI CYCGRG 1 cut(s) 1106
BsiSI CCGG 3 cut(s) 689, 883, 923
BslFI GGGAC 3 cut(s) 278, 317, 558
BslI CCNNNNNNNGG 2 cut(s) 178, 889
BsmAI GTCTC 1 cut(s) 1096
BsmFI GGGAC 3 cut(s) 278, 317, 558
BsmI GAATGC 1 cut(s) 10
BsoBI CYCGRG 1 cut(s) 1106
Bsp1286I GDGCHC 1 cut(s) 597
Bsp143I GATC 2 cut(s) 654, 905
BspACI CCGC 2 cut(s) 248, 608
BspHI TCATGA 1 cut(s) 100
BspLI GGNNCC 2 cut(s) 663, 913
BspMI ACCTGC 1 cut(s) 336
BspPI GGATC 1 cut(s) 649
BspQI GCTCTTC 1 cut(s) 180
BspT107I GGYRCC 1 cut(s) 661
BsrFI RCCGGY 2 cut(s) 688, 882
BsrI ACTGG 1 cut(s) 282
BssAI RCCGGY 2 cut(s) 688, 882
BssECI CCNNGG 2 cut(s) 519, 753
BssMI GATC 2 cut(s) 654, 905
BssNI GRCGYC 1 cut(s) 291
BssT1I CCWWGG 1 cut(s) 519
Bst2UI CCWGG 3 cut(s) 659, 738, 755
Bst4CI ACNGT 2 cut(s) 82, 985
Bst6I CTCTTC 4 cut(s) 180, 363, 1127, 1132
BstACI GRCGYC 1 cut(s) 291
BstC8I GCNNGC 1 cut(s) 884
BstDEI CTNAG 1 cut(s) 258
BstF5I GGATG 3 cut(s) 29, 187, 1092
BstKTI GATC 2 cut(s) 657, 908
BstMAI GTCTC 1 cut(s) 1096
BstMBI GATC 2 cut(s) 654, 905
BstMWI GCNNNNNNNGC 2 cut(s) 259, 948
BstNI CCWGG 3 cut(s) 659, 738, 755
BstNSI RCATGY 4 cut(s) 48, 220, 646, 1063
BstSCI CCNGG 4 cut(s) 657, 736, 753, 921
BstV1I GCAGC 2 cut(s) 177, 262
BstV2I GAAGAC 1 cut(s) 219
BstXI CCANNNNNNTGG 1 cut(s) 737
BtsCI GGATG 3 cut(s) 29, 187, 1092
BveI ACCTGC 1 cut(s) 336
Cac8I GCNNGC 1 cut(s) 884
CciI TCATGA 1 cut(s) 100
Cfr10I RCCGGY 2 cut(s) 688, 882
Cfr13I GGNCC 1 cut(s) 721
CviAII CATG 9 cut(s) 45, 101, 217, 303, 643, 814, 857, 979, 1060
DdeI CTNAG 1 cut(s) 258
DpnI GATC 2 cut(s) 656, 907
DpnII GATC 2 cut(s) 654, 905
Eam1104I CTCTTC 4 cut(s) 180, 363, 1127, 1132
EarI CTCTTC 4 cut(s) 180, 363, 1127, 1132
Eco130I CCWWGG 1 cut(s) 519
Eco47I GGWCC 1 cut(s) 721
Eco88I CYCGRG 1 cut(s) 1106
EcoRII CCWGG 3 cut(s) 657, 736, 753
EcoT14I CCWWGG 1 cut(s) 519
ErhI CCWWGG 1 cut(s) 519
FaeI CATG 9 cut(s) 48, 104, 220, 306, 646, 817, 860, 982, 1063
FaqI GGGAC 3 cut(s) 278, 317, 558
FatI CATG 9 cut(s) 44, 100, 216, 302, 642, 813, 856, 978, 1059
FauNDI CATATG 2 cut(s) 732, 747
FblI GTMKAC 1 cut(s) 900
Fnu4HI GCNGC 4 cut(s) 191, 248, 251, 608
FokI GGATG 3 cut(s) 36, 194, 1079
Fsp4HI GCNGC 4 cut(s) 191, 248, 251, 608
FspBI CTAG 3 cut(s) 173, 342, 948
GluI GCNGC 4 cut(s) 191, 248, 251, 608
GsuI CTGGAG 3 cut(s) 489, 599, 930
HapII CCGG 3 cut(s) 689, 883, 923
Hin1I GRCGYC 1 cut(s) 291
Hin1II CATG 9 cut(s) 48, 104, 220, 306, 646, 817, 860, 982, 1063
HinfI GANTC 5 cut(s) 355, 448, 893, 926, 1104
HpaII CCGG 3 cut(s) 689, 883, 923
HphI GGTGA 1 cut(s) 698
Hpy166II GTNNAC 2 cut(s) 694, 901
Hpy188I TCNGA 1 cut(s) 313
Hpy188III TCNNGA 5 cut(s) 101, 452, 578, 909, 935
Hpy8I GTNNAC 2 cut(s) 694, 901
Hpy99I CGWCG 1 cut(s) 566
HpyAV CCTTC 5 cut(s) 406, 451, 476, 719, 1061
HpyCH4III ACNGT 2 cut(s) 82, 985
HpyCH4IV ACGT 2 cut(s) 291, 1150
HpyCH4V TGCA 5 cut(s) 8, 220, 434, 856, 978
HpyF10VI GCNNNNNNNGC 2 cut(s) 259, 948
HpyF3I CTNAG 1 cut(s) 258
HpySE526I ACGT 2 cut(s) 291, 1150
Hsp92I GRCGYC 1 cut(s) 291
Hsp92II CATG 9 cut(s) 48, 104, 220, 306, 646, 817, 860, 982, 1063
KroI GCCGGC 1 cut(s) 882
KroNI GCCGGC 1 cut(s) 884
Kzo9I GATC 2 cut(s) 654, 905
LguI GCTCTTC 1 cut(s) 180
LmnI GCTCC 4 cut(s) 143, 406, 592, 911
Lsp1109I GCAGC 2 cut(s) 177, 262
LweI GCATC 1 cut(s) 495
MaeI CTAG 3 cut(s) 173, 342, 948
MaeII ACGT 2 cut(s) 291, 1150
MaeIII GTNAC 2 cut(s) 76, 1055
MalI GATC 2 cut(s) 656, 907
MboI GATC 2 cut(s) 654, 905
MboII GAAGA 8 cut(s) 197, 221, 224, 380, 485, 1083, 1144, 1149
MhlI GDGCHC 1 cut(s) 597
MlyI GAGTC 2 cut(s) 902, 1098
MmeI TCCRAC 3 cut(s) 121, 508, 1157
MroNI GCCGGC 1 cut(s) 882
MroXI GAANNNNTTC 1 cut(s) 930
MseI TTAA 2 cut(s) 84, 650
MslI CAYNNNNRTG 2 cut(s) 99, 1097
MspI CCGG 3 cut(s) 689, 883, 923
MspR9I CCNGG 4 cut(s) 659, 738, 755, 923
Mva1269I GAATGC 1 cut(s) 10
MvaI CCWGG 3 cut(s) 659, 738, 755
MwoI GCNNNNNNNGC 2 cut(s) 259, 948
NaeI GCCGGC 1 cut(s) 884
NciI CCSGG 1 cut(s) 923
NdeI CATATG 2 cut(s) 732, 747
NdeII GATC 2 cut(s) 654, 905
NgoMIV GCCGGC 1 cut(s) 882
NlaIII CATG 9 cut(s) 48, 104, 220, 306, 646, 817, 860, 982, 1063
NlaIV GGNNCC 2 cut(s) 663, 913
NmuCI GTSAC 1 cut(s) 76
NspI RCATGY 4 cut(s) 48, 220, 646, 1063
PaeR7I CTCGAG 1 cut(s) 1106
PagI TCATGA 1 cut(s) 100
PciI ACATGT 2 cut(s) 44, 642
PciSI GCTCTTC 1 cut(s) 180
PctI GAATGC 1 cut(s) 10
PdiI GCCGGC 1 cut(s) 884
PdmI GAANNNNTTC 1 cut(s) 930
PfeI GAWTC 3 cut(s) 355, 448, 926
PkrI GCNGC 4 cut(s) 192, 249, 252, 609
PleI GAGTC 2 cut(s) 901, 1098
PpsI GAGTC 2 cut(s) 901, 1098
PscI ACATGT 2 cut(s) 44, 642
PsiI TTATAA 2 cut(s) 972, 999
Psp1406I AACGTT 1 cut(s) 1150
Psp6I CCWGG 3 cut(s) 657, 736, 753
PspGI CCWGG 3 cut(s) 657, 736, 753
PspN4I GGNNCC 2 cut(s) 663, 913
PspPI GGNCC 1 cut(s) 721
PspXI VCTCGAGB 1 cut(s) 1106
RseI CAYNNNNRTG 2 cut(s) 99, 1097
SapI GCTCTTC 1 cut(s) 180
SaqAI TTAA 2 cut(s) 84, 650
SatI GCNGC 4 cut(s) 191, 248, 251, 608
Sau3AI GATC 2 cut(s) 654, 905
Sau96I GGNCC 1 cut(s) 721
SchI GAGTC 2 cut(s) 902, 1098
ScrFI CCNGG 4 cut(s) 659, 738, 755, 923
SduI GDGCHC 1 cut(s) 597
SfaNI GCATC 1 cut(s) 495
Sfr274I CTCGAG 1 cut(s) 1106
SinI GGWCC 1 cut(s) 721
SlaI CTCGAG 1 cut(s) 1106
SmiMI CAYNNNNRTG 2 cut(s) 99, 1097
SmlI CTYRAG 1 cut(s) 1106
SmoI CTYRAG 1 cut(s) 1106
SsiI CCGC 2 cut(s) 248, 608
SspMI CTAG 3 cut(s) 173, 342, 948
StyD4I CCNGG 4 cut(s) 657, 736, 753, 921
StyI CCWWGG 1 cut(s) 519
TaaI ACNGT 2 cut(s) 82, 985
TaiI ACGT 2 cut(s) 294, 1153
TaqI TCGA 2 cut(s) 561, 1107
TauI GCSGC 2 cut(s) 250, 610
TfiI GAWTC 3 cut(s) 355, 448, 926
Tru1I TTAA 2 cut(s) 84, 650
Tru9I TTAA 2 cut(s) 84, 650
TseFI GTSAC 1 cut(s) 76
TseI GCWGC 2 cut(s) 190, 250
Tsp45I GTSAC 1 cut(s) 76
TspDTI ATGAA 4 cut(s) 17, 198, 574, 1143
VpaK11BI GGWCC 1 cut(s) 721
XapI RAATTY 4 cut(s) 423, 618, 674, 1044
XceI RCATGY 4 cut(s) 48, 220, 646, 1063
XhoI CTCGAG 1 cut(s) 1106
XmiI GTMKAC 1 cut(s) 900
XmnI GAANNNNTTC 1 cut(s) 930
XspI CTAG 3 cut(s) 173, 342, 948
ZraI GACGTC 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.