Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr1

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

1496295 .. 1499903

Gene Structure 3609 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom01g01580.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 591 bp

ATGAGATACCTTTGCTTTGAAGAAGCGGTGAATGAATCAGCACATGCTTCAATCCGCCGTTTTCTCCTGGGTCATATGTACTCCAGGCATCTGGTATCATCTTTGGGGAAGAAGAAAGAATTGAGTATTTCGAAAGGCTTTGTTGGGAGTGCGCCCTCAGAGGTGAGGGAGAGTTGGGCATTTTCTTCAGGTTTGCCCTGCCATAAAAGACGAAGGTCGACATATATAGAGATAATATCAAAGAAAGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTAGGCACCTTTTTCCTGGCTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCCGCTCCGATGCCTCCCGCTCCGATGCCTTCCGCTCCAATGCCTTCCGCTCCAATGCCTTCTGCTTCAAAGCCTTCTGCTTCGACGCCTCGTAGTGGGGCTTCACGTAAACAACCTTTGGTGTTTGTGGTGTGTTGTGTATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

197

Amino Acids

21.15

Weight (kDa)

9.87

Isoelectric Point (pI)

79.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	378
AccB7I	CCANNNNNTGG	1 cut(s)	405
AccBSI	CCGCTC	4 cut(s)	452, 467, 482, 497
AccI	GTMKAC	1 cut(s)	218
AciI	CCGC	6 cut(s)	26, 55, 450, 465, 480, 495
AcoI	YGGCCR	2 cut(s)	330, 407
AcuI	CTGAAG	1 cut(s)	171
AcyI	GRCGYC	2 cut(s)	249, 533
AdeI	CACNNNGTG	1 cut(s)	356
AfaI	GTAC	1 cut(s)	80
AfeI	AGCGCT	1 cut(s)	403
AfiI	CCNNNNNNNGG	2 cut(s)	405, 542
AgsI	TTSAA	4 cut(s)	20, 51, 338, 516
AjnI	CCWGG	4 cut(s)	66, 83, 388, 422
AluBI	AGCT	3 cut(s)	260, 272, 437
AluI	AGCT	3 cut(s)	260, 272, 437
Aor51HI	AGCGCT	1 cut(s)	403
AoxI	GGCC	3 cut(s)	330, 407, 420
ApeKI	GCWGC	1 cut(s)	304
AspLEI	GCGC	2 cut(s)	154, 404
AspS9I	GGNCC	1 cut(s)	318
AsuHPI	GGTGA	2 cut(s)	40, 175
AsuII	TTCGAA	1 cut(s)	131
AvaII	GGWCC	1 cut(s)	318
BalI	TGGCCA	1 cut(s)	409
BanI	GGYRCC	1 cut(s)	378
BarI	GAAGNNNNNNTAC	2 cut(s)	532, 564
BbvI	GCAGC	1 cut(s)	291
BceAI	ACGGC	2 cut(s)	42, 317
BciT130I	CCWGG	4 cut(s)	68, 85, 390, 424
BfaI	CTAG	3 cut(s)	273, 375, 434
BfoI	RGCGCY	1 cut(s)	405
BisI	GCNGC	1 cut(s)	305
BlsI	GCNGC	1 cut(s)	306
Bme1390I	CCNGG	4 cut(s)	68, 85, 390, 424
Bme18I	GGWCC	1 cut(s)	318
BmgT120I	GGNCC	1 cut(s)	318
BmiI	GGNNCC	2 cut(s)	278, 380
BmrFI	CCNGG	4 cut(s)	68, 85, 390, 424
BmsI	GCATC	4 cut(s)	97, 432, 447, 462
BoxI	GACNNNNGTC	1 cut(s)	214
BpmI	CTGGAG	1 cut(s)	67
Bpu14I	TTCGAA	1 cut(s)	131
BsaAI	YACGTR	1 cut(s)	554
BsaHI	GRCGYC	2 cut(s)	249, 533
BsaJI	CCNNGG	1 cut(s)	67
Bsc4I	CCNNNNNNNGG	2 cut(s)	405, 542
BseBI	CCWGG	4 cut(s)	68, 85, 390, 424
BseDI	CCNNGG	1 cut(s)	67
BseGI	GGATG	1 cut(s)	395
BseLI	CCNNNNNNNGG	2 cut(s)	405, 542
BseMII	CTCAG	1 cut(s)	171
BseRI	GAGGAG	1 cut(s)	272
BseXI	GCAGC	1 cut(s)	291
BshFI	GGCC	3 cut(s)	332, 409, 422
BshNI	GGYRCC	1 cut(s)	378
BslFI	GGGAC	1 cut(s)	328
BslI	CCNNNNNNNGG	2 cut(s)	405, 542
BsmFI	GGGAC	1 cut(s)	328
BsmI	GAATGC	1 cut(s)	433
BsnI	GGCC	3 cut(s)	332, 409, 422
Bsp119I	TTCGAA	1 cut(s)	131
BspACI	CCGC	6 cut(s)	26, 55, 450, 465, 480, 495
BspANI	GGCC	3 cut(s)	332, 409, 422
BspCNI	CTCAG	1 cut(s)	170
BspLI	GGNNCC	2 cut(s)	278, 380
BspT104I	TTCGAA	1 cut(s)	131
BspT107I	GGYRCC	1 cut(s)	378
BsrBI	CCGCTC	4 cut(s)	452, 467, 482, 497
BssECI	CCNNGG	1 cut(s)	67
BssNI	GRCGYC	2 cut(s)	249, 533
Bst2UI	CCWGG	4 cut(s)	68, 85, 390, 424
Bst4CI	ACNGT	1 cut(s)	318
BstACI	GRCGYC	2 cut(s)	249, 533
BstBAI	YACGTR	1 cut(s)	554
BstBI	TTCGAA	1 cut(s)	131
BstDEI	CTNAG	2 cut(s)	157, 353
BstF5I	GGATG	1 cut(s)	395
BstH2I	RGCGCY	1 cut(s)	405
BstHHI	GCGC	2 cut(s)	154, 404
BstMWI	GCNNNNNNNGC	3 cut(s)	257, 399, 428
BstNI	CCWGG	4 cut(s)	68, 85, 390, 424
BstNSI	RCATGY	1 cut(s)	47
BstPAI	GACNNNNGTC	1 cut(s)	214
BstSCI	CCNGG	4 cut(s)	66, 83, 388, 422
BstV1I	GCAGC	1 cut(s)	291
BstXI	CCANNNNNNTGG	1 cut(s)	91
BsuRI	GGCC	3 cut(s)	332, 409, 422
BtsCI	GGATG	1 cut(s)	395
BtsIMutI	CAGTG	1 cut(s)	368
CfoI	GCGC	2 cut(s)	154, 404
Cfr13I	GGNCC	1 cut(s)	318
CpoI	CGGWCCG	1 cut(s)	318
CseI	GACGC	2 cut(s)	257, 541
Csp6I	GTAC	1 cut(s)	79
CspI	CGGWCCG	1 cut(s)	318
CviAII	CATG	1 cut(s)	44
CviQI	GTAC	1 cut(s)	79
DdeI	CTNAG	2 cut(s)	157, 353
DraIII	CACNNNGTG	1 cut(s)	356
EaeI	YGGCCR	2 cut(s)	330, 407
EciI	GGCGGA	1 cut(s)	44
Eco147I	AGGCCT	1 cut(s)	422
Eco47I	GGWCC	1 cut(s)	318
Eco47III	AGCGCT	1 cut(s)	403
Eco57I	CTGAAG	1 cut(s)	171
EcoRII	CCWGG	4 cut(s)	66, 83, 388, 422
FaeI	CATG	1 cut(s)	47
FaiI	YATR	8 cut(s)	45, 75, 77, 204, 223, 225, 227, 589
FaqI	GGGAC	1 cut(s)	328
FatI	CATG	1 cut(s)	43
FauI	CCCGC	2 cut(s)	457, 472
FauNDI	CATATG	1 cut(s)	75
FblI	GTMKAC	1 cut(s)	218
Fnu4HI	GCNGC	1 cut(s)	305
FokI	GGATG	1 cut(s)	382
Fsp4HI	GCNGC	1 cut(s)	305
FspBI	CTAG	3 cut(s)	273, 375, 434
GlaI	GCGC	2 cut(s)	153, 403
GluI	GCNGC	1 cut(s)	305
GsuI	CTGGAG	1 cut(s)	67
HaeII	RGCGCY	1 cut(s)	405
HaeIII	GGCC	3 cut(s)	332, 409, 422
HgaI	GACGC	2 cut(s)	257, 541
HhaI	GCGC	2 cut(s)	154, 404
Hin1I	GRCGYC	2 cut(s)	249, 533
Hin1II	CATG	1 cut(s)	47
Hin6I	GCGC	2 cut(s)	152, 402
HinP1I	GCGC	2 cut(s)	152, 402
HincII	GTYRAC	1 cut(s)	219
HindII	GTYRAC	1 cut(s)	219
HinfI	GANTC	2 cut(s)	35, 341
HphI	GGTGA	2 cut(s)	40, 175
Hpy166II	GTNNAC	2 cut(s)	219, 557
Hpy188I	TCNGA	5 cut(s)	160, 322, 441, 456, 471
Hpy188III	TCNNGA	2 cut(s)	312, 338
Hpy8I	GTNNAC	2 cut(s)	219, 557
Hpy99I	CGWCG	1 cut(s)	535
HpyAV	CCTTC	5 cut(s)	207, 486, 501, 516, 531
HpyCH4III	ACNGT	1 cut(s)	318
HpyCH4IV	ACGT	1 cut(s)	553
HpyF10VI	GCNNNNNNNGC	3 cut(s)	257, 399, 428
HpyF3I	CTNAG	2 cut(s)	157, 353
HpySE526I	ACGT	1 cut(s)	553
Hsp92I	GRCGYC	2 cut(s)	249, 533
Hsp92II	CATG	1 cut(s)	47
HspAI	GCGC	2 cut(s)	152, 402
LmnI	GCTCC	5 cut(s)	442, 457, 472, 487, 502
Lsp1109I	GCAGC	1 cut(s)	291
LweI	GCATC	4 cut(s)	97, 432, 447, 462
MaeI	CTAG	3 cut(s)	273, 375, 434
MaeII	ACGT	1 cut(s)	553
MbiI	CCGCTC	4 cut(s)	452, 467, 482, 497
MboII	GAAGA	4 cut(s)	32, 121, 124, 177
MlsI	TGGCCA	1 cut(s)	409
MluCI	AATT	1 cut(s)	119
MluNI	TGGCCA	1 cut(s)	409
MlyI	GAGTC	1 cut(s)	350
Mox20I	TGGCCA	1 cut(s)	409
MscI	TGGCCA	1 cut(s)	409
Msp20I	TGGCCA	1 cut(s)	409
MspR9I	CCNGG	4 cut(s)	68, 85, 390, 424
Mva1269I	GAATGC	1 cut(s)	433
MvaI	CCWGG	4 cut(s)	68, 85, 390, 424
MwoI	GCNNNNNNNGC	3 cut(s)	257, 399, 428
NdeI	CATATG	1 cut(s)	75
NlaIII	CATG	1 cut(s)	47
NlaIV	GGNNCC	2 cut(s)	278, 380
NspI	RCATGY	1 cut(s)	47
NspV	TTCGAA	1 cut(s)	131
PceI	AGGCCT	1 cut(s)	422
PctI	GAATGC	1 cut(s)	433
PfeI	GAWTC	1 cut(s)	35
PflMI	CCANNNNNTGG	1 cut(s)	405
PkrI	GCNGC	1 cut(s)	306
PleI	GAGTC	1 cut(s)	349
PpsI	GAGTC	1 cut(s)	349
Ppu21I	YACGTR	1 cut(s)	554
PshAI	GACNNNNGTC	1 cut(s)	214
Psp6I	CCWGG	4 cut(s)	66, 83, 388, 422
PspGI	CCWGG	4 cut(s)	66, 83, 388, 422
PspN4I	GGNNCC	2 cut(s)	278, 380
PspPI	GGNCC	1 cut(s)	318
RsaI	GTAC	1 cut(s)	80
RsaNI	GTAC	1 cut(s)	79
Rsr2I	CGGWCCG	1 cut(s)	318
RsrII	CGGWCCG	1 cut(s)	318
SalI	GTCGAC	1 cut(s)	217
SatI	GCNGC	1 cut(s)	305
Sau96I	GGNCC	1 cut(s)	318
SchI	GAGTC	1 cut(s)	350
ScrFI	CCNGG	4 cut(s)	68, 85, 390, 424
SfaNI	GCATC	4 cut(s)	97, 432, 447, 462
SfuI	TTCGAA	1 cut(s)	131
SinI	GGWCC	1 cut(s)	318
Sse9I	AATT	1 cut(s)	119
SseBI	AGGCCT	1 cut(s)	422
SsiI	CCGC	6 cut(s)	26, 55, 450, 465, 480, 495
SspMI	CTAG	3 cut(s)	273, 375, 434
StuI	AGGCCT	1 cut(s)	422
StyD4I	CCNGG	4 cut(s)	66, 83, 388, 422
TaaI	ACNGT	1 cut(s)	318
TaiI	ACGT	1 cut(s)	556
TaqI	TCGA	3 cut(s)	131, 218, 530
TasI	AATT	1 cut(s)	119
TatI	WGTACW	1 cut(s)	78
TfiI	GAWTC	1 cut(s)	35
TscAI	CASTG	1 cut(s)	368
TseI	GCWGC	1 cut(s)	304
TspDTI	ATGAA	1 cut(s)	48
TspRI	CASTG	1 cut(s)	368
Van91I	CCANNNNNTGG	1 cut(s)	405
VpaK11BI	GGWCC	1 cut(s)	318
XceI	RCATGY	1 cut(s)	47
XmiI	GTMKAC	1 cut(s)	218
XspI	CTAG	3 cut(s)	273, 375, 434

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.