pycom555g00010

Zinc finger MYM-type protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_555
OG0000120
Physical Location & Seq
Forward (+)
648 .. 11242
10595 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom555g00010.2

Sequence Viewer

Length: 261 bp
ATGTGGTTAATGATTCAGTCACCCAATCTGGAATTTAAACTATTACCGGATCATTTCAAGTATCACCGCCCATTCAAAGATAAATTCCATGCCACTAAACATGGAGAAAGATGGAGCCTTCACAGAGGATGTTTACGTGAAGCCCCGCTACGAGGCGTCGAAGCAGAAGGAATAGAAGCGGAAGGCATAGGAGCGGAAGGCGCAGAAGCAGGAGGCATCGGAGCGGAAGCCATCGGACCGCGAATGCGTCCACGGAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

87

Amino Acids

9.65

Weight (kDa)

7.98

Isoelectric Point (pI)

37.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 194, 224
AccII CGCG 1 cut(s) 241
AciI CCGC 6 cut(s) 67, 146, 179, 194, 224, 239
AclWI GGATC 1 cut(s) 57
AcsI RAATTY 2 cut(s) 32, 83
AcyI GRCGYC 1 cut(s) 156
AfiI CCNNNNNNNGG 1 cut(s) 152
AgsI TTSAA 2 cut(s) 58, 76
AluBI AGCT 1 cut(s) 258
AluI AGCT 1 cut(s) 258
AlwI GGATC 1 cut(s) 57
ApoI RAATTY 2 cut(s) 32, 83
AspLEI GCGC 1 cut(s) 203
AspS9I GGNCC 1 cut(s) 236
AsuHPI GGTGA 2 cut(s) 12, 56
AvaII GGWCC 1 cut(s) 236
BarI GAAGNNNNNNTAC 2 cut(s) 132, 164
BccI CCATC 2 cut(s) 105, 239
BfaI CTAG 1 cut(s) 259
Bme18I GGWCC 1 cut(s) 236
BmgT120I GGNCC 1 cut(s) 236
BmiI GGNNCC 1 cut(s) 116
BmsI GCATC 1 cut(s) 225
BsaAI YACGTR 1 cut(s) 137
BsaHI GRCGYC 1 cut(s) 156
BsaJI CCNNGG 1 cut(s) 251
BsaWI WCCGGW 1 cut(s) 46
Bsc4I CCNNNNNNNGG 1 cut(s) 152
BseDI CCNNGG 1 cut(s) 251
BseGI GGATG 1 cut(s) 134
BseLI CCNNNNNNNGG 1 cut(s) 152
Bsh1236I CGCG 1 cut(s) 241
BsiSI CCGG 1 cut(s) 47
BslI CCNNNNNNNGG 1 cut(s) 152
BsmI GAATGC 1 cut(s) 249
Bsp143I GATC 1 cut(s) 49
BspACI CCGC 6 cut(s) 67, 146, 179, 194, 224, 239
BspFNI CGCG 1 cut(s) 241
BspLI GGNNCC 1 cut(s) 116
BspPI GGATC 1 cut(s) 57
BsrBI CCGCTC 2 cut(s) 194, 224
BssECI CCNNGG 1 cut(s) 251
BssMI GATC 1 cut(s) 49
BssNI GRCGYC 1 cut(s) 156
BstACI GRCGYC 1 cut(s) 156
BstBAI YACGTR 1 cut(s) 137
BstDSI CCRYGG 1 cut(s) 251
BstF5I GGATG 1 cut(s) 134
BstFNI CGCG 1 cut(s) 241
BstHHI GCGC 1 cut(s) 203
BstKTI GATC 1 cut(s) 52
BstMBI GATC 1 cut(s) 49
BstMWI GCNNNNNNNGC 1 cut(s) 200
BstUI CGCG 1 cut(s) 241
BtgI CCRYGG 1 cut(s) 251
BtsCI GGATG 1 cut(s) 134
CfoI GCGC 1 cut(s) 203
Cfr13I GGNCC 1 cut(s) 236
CpoI CGGWCCG 1 cut(s) 236
CseI GACGC 2 cut(s) 145, 236
CspI CGGWCCG 1 cut(s) 236
CviAII CATG 2 cut(s) 89, 101
CviJI RGCY 4 cut(s) 117, 143, 230, 258
CviKI_1 RGCY 4 cut(s) 117, 143, 230, 258
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
DraI TTTAAA 1 cut(s) 37
Eco47I GGWCC 1 cut(s) 236
FaeI CATG 2 cut(s) 92, 104
FaiI YATR 3 cut(s) 90, 102, 188
FatI CATG 2 cut(s) 88, 100
FauI CCCGC 1 cut(s) 153
FokI GGATG 1 cut(s) 141
FspBI CTAG 1 cut(s) 259
GlaI GCGC 1 cut(s) 202
HapII CCGG 1 cut(s) 47
HgaI GACGC 2 cut(s) 145, 236
HhaI GCGC 1 cut(s) 203
Hin1I GRCGYC 1 cut(s) 156
Hin1II CATG 2 cut(s) 92, 104
Hin6I GCGC 1 cut(s) 201
HinP1I GCGC 1 cut(s) 201
HinfI GANTC 1 cut(s) 13
HpaII CCGG 1 cut(s) 47
HphI GGTGA 2 cut(s) 12, 56
Hpy166II GTNNAC 2 cut(s) 134, 251
Hpy188I TCNGA 2 cut(s) 221, 236
Hpy188III TCNNGA 1 cut(s) 29
Hpy8I GTNNAC 2 cut(s) 134, 251
Hpy99I CGWCG 1 cut(s) 161
HpyAV CCTTC 4 cut(s) 128, 161, 176, 191
HpyCH4IV ACGT 1 cut(s) 136
HpyF10VI GCNNNNNNNGC 1 cut(s) 200
HpySE526I ACGT 1 cut(s) 136
Hsp92I GRCGYC 1 cut(s) 156
Hsp92II CATG 2 cut(s) 92, 104
HspAI GCGC 1 cut(s) 201
Kzo9I GATC 1 cut(s) 49
LmnI GCTCC 4 cut(s) 114, 191, 221, 255
LpnPI CCDG 3 cut(s) 14, 60, 195
LweI GCATC 1 cut(s) 225
MaeI CTAG 1 cut(s) 259
MaeII ACGT 1 cut(s) 136
MaeIII GTNAC 1 cut(s) 18
MalI GATC 1 cut(s) 51
MbiI CCGCTC 2 cut(s) 194, 224
MboI GATC 1 cut(s) 49
MluCI AATT 2 cut(s) 32, 83
MnlI CCTC 3 cut(s) 119, 146, 206
MseI TTAA 2 cut(s) 8, 36
MspI CCGG 1 cut(s) 47
Mva1269I GAATGC 1 cut(s) 249
MvnI CGCG 1 cut(s) 241
MwoI GCNNNNNNNGC 1 cut(s) 200
NdeII GATC 1 cut(s) 49
NlaIII CATG 2 cut(s) 92, 104
NlaIV GGNNCC 1 cut(s) 116
NmuCI GTSAC 1 cut(s) 18
PctI GAATGC 1 cut(s) 249
PfeI GAWTC 1 cut(s) 13
Ppu21I YACGTR 1 cut(s) 137
PspN4I GGNNCC 1 cut(s) 116
PspPI GGNCC 1 cut(s) 236
Rsr2I CGGWCCG 1 cut(s) 236
RsrII CGGWCCG 1 cut(s) 236
SaqAI TTAA 2 cut(s) 8, 36
Sau3AI GATC 1 cut(s) 49
Sau96I GGNCC 1 cut(s) 236
SetI ASST 2 cut(s) 139, 260
SfaNI GCATC 1 cut(s) 225
SinI GGWCC 1 cut(s) 236
Sse9I AATT 2 cut(s) 32, 83
SsiI CCGC 6 cut(s) 67, 146, 179, 194, 224, 239
SspMI CTAG 1 cut(s) 259
TaiI ACGT 1 cut(s) 139
TaqI TCGA 1 cut(s) 159
TasI AATT 2 cut(s) 32, 83
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 2 cut(s) 8, 36
Tru9I TTAA 2 cut(s) 8, 36
TseFI GTSAC 1 cut(s) 18
Tsp45I GTSAC 1 cut(s) 18
VpaK11BI GGWCC 1 cut(s) 236
XapI RAATTY 2 cut(s) 32, 83
XspI CTAG 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.