pycom08g12370

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
Physical Location & Seq
Forward (+)
10801825 .. 10803681
1857 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g12370.1

Sequence Viewer

Length: 612 bp
ATGACTAACTCATCGAACCTTTGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGTGCCCCGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTACAGGTGAAGACTCTGTGATGAAGGACGCAACAACAGCTACGATAGTAGCTAGGAACCTCCTCACTCCTGAAGATAGTCGACTGCTTTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTCAGCGTTCAGTGTGCAGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGCTCCCGTCAGGTTGAATCGTTGATGGCAGAGGTGGAAAGTCTCAAGCAAGAGATCAAGCAGCTGAAGTATGAGAATAGAAGTTTGCACGTACTTGCAAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAGTCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACCTTTTTCCTGGGTCTTCCAGCGTTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTTCAACGCCTCCCCCACACCAACTCCTGAAATGGCAAAATTCTCTTCATTTGCTATAA

Protein Analysis

204

Amino Acids

22.58

Weight (kDa)

6.91

Isoelectric Point (pI)

55.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 78, 495
AccB7I CCANNNNNTGG 1 cut(s) 522
AccI GTMKAC 1 cut(s) 190
AclWI GGATC 1 cut(s) 41
AcoI YGGCCR 2 cut(s) 219, 524
AcsI RAATTY 1 cut(s) 592
AcuI CTGAAG 3 cut(s) 201, 380, 465
AcyI GRCGYC 1 cut(s) 79
AfaI GTAC 1 cut(s) 387
AfiI CCNNNNNNNGG 3 cut(s) 65, 113, 522
AgsI TTSAA 4 cut(s) 227, 311, 458, 558
AjnI CCWGG 2 cut(s) 505, 539
AluBI AGCT 6 cut(s) 149, 161, 358, 424, 433, 554
AluI AGCT 6 cut(s) 149, 161, 358, 424, 433, 554
Alw26I GTCTC 2 cut(s) 41, 341
AlwI GGATC 1 cut(s) 41
AlwNI CAGNNNCTG 1 cut(s) 263
AoxI GGCC 4 cut(s) 219, 277, 524, 537
ApeKI GCWGC 3 cut(s) 42, 355, 433
ApoI RAATTY 1 cut(s) 592
ArsI GACNNNNNNTTYG 2 cut(s) 451, 483
AspLEI GCGC 1 cut(s) 81
AspS9I GGNCC 3 cut(s) 104, 207, 277
AsuHPI GGTGA 1 cut(s) 128
AvaII GGWCC 2 cut(s) 104, 207
BaeGI GKGCMC 1 cut(s) 60
BalI TGGCCA 1 cut(s) 526
BanI GGYRCC 2 cut(s) 78, 495
BbsI GAAGAC 2 cut(s) 126, 504
BbvI GCAGC 3 cut(s) 54, 367, 420
BccI CCATC 1 cut(s) 313
BceAI ACGGC 1 cut(s) 206
BciT130I CCWGG 2 cut(s) 507, 541
BcoDI GTCTC 2 cut(s) 41, 341
BfaI CTAG 2 cut(s) 162, 551
BfoI RGCGCY 1 cut(s) 82
BisI GCNGC 3 cut(s) 43, 356, 434
BlsI GCNGC 3 cut(s) 44, 357, 435
Bme1390I CCNGG 2 cut(s) 507, 541
Bme18I GGWCC 2 cut(s) 104, 207
BmgT120I GGNCC 3 cut(s) 104, 207, 277
BmiI GGNNCC 3 cut(s) 80, 167, 497
BmrFI CCNGG 2 cut(s) 507, 541
BpiI GAAGAC 2 cut(s) 126, 504
BpmI CTGGAG 1 cut(s) 473
BpuEI CTTGAG 1 cut(s) 323
BsaAI YACGTR 1 cut(s) 385
BsaHI GRCGYC 1 cut(s) 79
BsaJI CCNNGG 1 cut(s) 506
BsaWI WCCGGW 1 cut(s) 49
BsaXI ACNNNNNCTCC 2 cut(s) 561, 591
Bsc4I CCNNNNNNNGG 3 cut(s) 65, 113, 522
BseBI CCWGG 2 cut(s) 507, 541
BseDI CCNNGG 1 cut(s) 506
BseLI CCNNNNNNNGG 3 cut(s) 65, 113, 522
BseMII CTCAG 2 cut(s) 52, 256
BseRI GAGGAG 1 cut(s) 161
BseSI GKGCMC 1 cut(s) 60
BseXI GCAGC 3 cut(s) 54, 367, 420
BsgI GTGCAG 1 cut(s) 276
BshFI GGCC 4 cut(s) 221, 279, 526, 539
BshNI GGYRCC 2 cut(s) 78, 495
BsiSI CCGG 1 cut(s) 50
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 3 cut(s) 65, 113, 522
BsmAI GTCTC 2 cut(s) 41, 341
BsmFI GGGAC 1 cut(s) 217
BsmI GAATGC 1 cut(s) 550
BsnI GGCC 4 cut(s) 221, 279, 526, 539
Bsp1286I GDGCHC 1 cut(s) 60
Bsp143I GATC 2 cut(s) 46, 348
BspANI GGCC 4 cut(s) 221, 279, 526, 539
BspCNI CTCAG 2 cut(s) 51, 255
BspLI GGNNCC 3 cut(s) 80, 167, 497
BspPI GGATC 1 cut(s) 41
BspT107I GGYRCC 2 cut(s) 78, 495
BssECI CCNNGG 1 cut(s) 506
BssMI GATC 2 cut(s) 46, 348
BssNI GRCGYC 1 cut(s) 79
Bst2UI CCWGG 2 cut(s) 507, 541
Bst4CI ACNGT 3 cut(s) 104, 207, 467
Bst6I CTCTTC 2 cut(s) 410, 603
BstACI GRCGYC 1 cut(s) 79
BstBAI YACGTR 1 cut(s) 385
BstC8I GCNNGC 2 cut(s) 259, 295
BstDEI CTNAG 3 cut(s) 25, 38, 242
BstENI CCTNNNNNAGG 1 cut(s) 111
BstH2I RGCGCY 1 cut(s) 82
BstHHI GCGC 1 cut(s) 81
BstKTI GATC 2 cut(s) 49, 351
BstMAI GTCTC 2 cut(s) 41, 341
BstMBI GATC 2 cut(s) 46, 348
BstMWI GCNNNNNNNGC 3 cut(s) 146, 430, 545
BstNI CCWGG 2 cut(s) 507, 541
BstSCI CCNGG 2 cut(s) 505, 539
BstSLI GKGCMC 1 cut(s) 60
BstV1I GCAGC 3 cut(s) 54, 367, 420
BstV2I GAAGAC 2 cut(s) 126, 504
BsuRI GGCC 4 cut(s) 221, 279, 526, 539
BtsIMutI CAGTG 1 cut(s) 257
Cac8I GCNNGC 2 cut(s) 259, 295
CaiI CAGNNNCTG 1 cut(s) 263
CfoI GCGC 1 cut(s) 81
Cfr13I GGNCC 3 cut(s) 104, 207, 277
CpoI CGGWCCG 1 cut(s) 207
CseI GACGC 1 cut(s) 146
Csp6I GTAC 1 cut(s) 386
CspI CGGWCCG 1 cut(s) 207
CviAII CATG 2 cut(s) 274, 412
CviQI GTAC 1 cut(s) 386
DdeI CTNAG 3 cut(s) 25, 38, 242
DinI GGCGCC 1 cut(s) 80
DpnI GATC 2 cut(s) 48, 350
DpnII GATC 2 cut(s) 46, 348
EaeI YGGCCR 2 cut(s) 219, 524
Eam1104I CTCTTC 2 cut(s) 410, 603
EarI CTCTTC 2 cut(s) 410, 603
Eco147I AGGCCT 1 cut(s) 539
Eco47I GGWCC 2 cut(s) 104, 207
Eco57I CTGAAG 3 cut(s) 201, 380, 465
EcoNI CCTNNNNNAGG 1 cut(s) 111
EcoRII CCWGG 2 cut(s) 505, 539
EgeI GGCGCC 1 cut(s) 80
EheI GGCGCC 1 cut(s) 80
FaeI CATG 2 cut(s) 277, 415
FaiI YATR 5 cut(s) 76, 275, 366, 413, 610
FaqI GGGAC 1 cut(s) 217
FatI CATG 2 cut(s) 273, 411
FblI GTMKAC 1 cut(s) 190
Fnu4HI GCNGC 3 cut(s) 43, 356, 434
Fsp4HI GCNGC 3 cut(s) 43, 356, 434
FspBI CTAG 2 cut(s) 162, 551
GlaI GCGC 1 cut(s) 80
GluI GCNGC 3 cut(s) 43, 356, 434
GsuI CTGGAG 1 cut(s) 473
HaeII RGCGCY 1 cut(s) 82
HaeIII GGCC 4 cut(s) 221, 279, 526, 539
HapII CCGG 1 cut(s) 50
HgaI GACGC 1 cut(s) 146
HhaI GCGC 1 cut(s) 81
Hin1I GRCGYC 1 cut(s) 79
Hin1II CATG 2 cut(s) 277, 415
Hin6I GCGC 1 cut(s) 79
HinP1I GCGC 1 cut(s) 79
HincII GTYRAC 1 cut(s) 191
HindII GTYRAC 1 cut(s) 191
HindIII AAGCTT 1 cut(s) 422
HinfI GANTC 6 cut(s) 34, 122, 230, 311, 440, 454
HpaII CCGG 1 cut(s) 50
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 191
Hpy188I TCNGA 3 cut(s) 211, 445, 453
Hpy188III TCNNGA 5 cut(s) 179, 201, 227, 490, 580
Hpy8I GTNNAC 1 cut(s) 191
Hpy99I CGWCG 1 cut(s) 409
HpyAV CCTTC 3 cut(s) 93, 127, 440
HpyCH4III ACNGT 3 cut(s) 104, 207, 467
HpyCH4IV ACGT 1 cut(s) 384
HpyCH4V TGCA 4 cut(s) 257, 382, 392, 436
HpyF10VI GCNNNNNNNGC 3 cut(s) 146, 430, 545
HpyF3I CTNAG 3 cut(s) 25, 38, 242
HpySE526I ACGT 1 cut(s) 384
Hsp92I GRCGYC 1 cut(s) 79
Hsp92II CATG 2 cut(s) 277, 415
HspAI GCGC 1 cut(s) 79
KasI GGCGCC 1 cut(s) 78
Kzo9I GATC 2 cut(s) 46, 348
LmnI GCTCC 1 cut(s) 302
Lsp1109I GCAGC 3 cut(s) 54, 367, 420
MaeI CTAG 2 cut(s) 162, 551
MaeII ACGT 1 cut(s) 384
MaeIII GTNAC 1 cut(s) 461
MalI GATC 2 cut(s) 48, 350
MboI GATC 2 cut(s) 46, 348
MboII GAAGA 6 cut(s) 87, 131, 194, 427, 504, 590
MhlI GDGCHC 1 cut(s) 60
MlsI TGGCCA 1 cut(s) 526
MluCI AATT 1 cut(s) 592
MluNI TGGCCA 1 cut(s) 526
Mly113I GGCGCC 1 cut(s) 79
MlyI GAGTC 4 cut(s) 43, 116, 239, 449
MmeI TCCRAC 2 cut(s) 294, 431
Mox20I TGGCCA 1 cut(s) 526
MscI TGGCCA 1 cut(s) 526
Msp20I TGGCCA 1 cut(s) 526
MspA1I CMGCKG 1 cut(s) 358
MspI CCGG 1 cut(s) 50
MspR9I CCNGG 2 cut(s) 507, 541
Mva1269I GAATGC 1 cut(s) 550
MvaI CCWGG 2 cut(s) 507, 541
MwoI GCNNNNNNNGC 3 cut(s) 146, 430, 545
NarI GGCGCC 1 cut(s) 79
NdeII GATC 2 cut(s) 46, 348
NlaIII CATG 2 cut(s) 277, 415
NlaIV GGNNCC 3 cut(s) 80, 167, 497
NmuCI GTSAC 1 cut(s) 461
PceI AGGCCT 1 cut(s) 539
PcsI WCGNNNNNNNCGW 1 cut(s) 243
PctI GAATGC 1 cut(s) 550
PfeI GAWTC 2 cut(s) 311, 454
PflMI CCANNNNNTGG 1 cut(s) 522
PkrI GCNGC 3 cut(s) 44, 357, 435
PleI GAGTC 4 cut(s) 42, 116, 238, 448
PluTI GGCGCC 1 cut(s) 82
PpsI GAGTC 4 cut(s) 42, 116, 238, 448
Ppu21I YACGTR 1 cut(s) 385
Psp6I CCWGG 2 cut(s) 505, 539
PspGI CCWGG 2 cut(s) 505, 539
PspN4I GGNNCC 3 cut(s) 80, 167, 497
PspPI GGNCC 3 cut(s) 104, 207, 277
PstNI CAGNNNCTG 1 cut(s) 263
PvuII CAGCTG 1 cut(s) 358
RsaI GTAC 1 cut(s) 387
RsaNI GTAC 1 cut(s) 386
Rsr2I CGGWCCG 1 cut(s) 207
RsrII CGGWCCG 1 cut(s) 207
SalI GTCGAC 1 cut(s) 189
SatI GCNGC 3 cut(s) 43, 356, 434
Sau3AI GATC 2 cut(s) 46, 348
Sau96I GGNCC 3 cut(s) 104, 207, 277
SchI GAGTC 4 cut(s) 43, 116, 239, 449
ScrFI CCNGG 2 cut(s) 507, 541
SduI GDGCHC 1 cut(s) 60
SfoI GGCGCC 1 cut(s) 80
SinI GGWCC 2 cut(s) 104, 207
SmlI CTYRAG 1 cut(s) 338
SmoI CTYRAG 1 cut(s) 338
Sse9I AATT 1 cut(s) 592
SseBI AGGCCT 1 cut(s) 539
SspDI GGCGCC 1 cut(s) 78
SspMI CTAG 2 cut(s) 162, 551
StuI AGGCCT 1 cut(s) 539
StyD4I CCNGG 2 cut(s) 505, 539
TaaI ACNGT 3 cut(s) 104, 207, 467
TaiI ACGT 1 cut(s) 387
TaqI TCGA 3 cut(s) 14, 190, 404
TasI AATT 1 cut(s) 592
TfiI GAWTC 2 cut(s) 311, 454
TscAI CASTG 1 cut(s) 257
TseFI GTSAC 1 cut(s) 461
TseI GCWGC 3 cut(s) 42, 355, 433
Tsp45I GTSAC 1 cut(s) 461
TspDTI ATGAA 3 cut(s) 146, 428, 590
TspRI CASTG 1 cut(s) 257
Van91I CCANNNNNTGG 1 cut(s) 522
VpaK11BI GGWCC 2 cut(s) 104, 207
XagI CCTNNNNNAGG 1 cut(s) 111
XapI RAATTY 1 cut(s) 592
XmiI GTMKAC 1 cut(s) 190
XspI CTAG 2 cut(s) 162, 551
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.