pycom07g11990

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0000120
Physical Location & Seq
Forward (+)
13320814 .. 13325092
4279 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g11990.2

Sequence Viewer

Length: 564 bp
ATGGCACTTGATAATGCTTCTCTTTTGTCACAACTCATGGAAAGGTCCCAAATGCAAAGAGTTGATATATTTAATCTTCAATCAAGGAATAACGTGTTTTCCAATACTTACAATTCGGATTGGAGTGATCATTCAAACTCTATGTGGTGGAAACCTCAAAATGCTCAACAAGGAGGATATTGGACAATTTCTGACAAAGCTGAAAACACGTGGAGGCCATCATCGCATCTACACATCTTTAGCCGACAAGCGCAAAGTTCGGCGACGCTTTCTCTGCTTTTCAGAAGACGCGTGCAGCTTTGTCAAAAGGAGCCGCATCTGCACTACCACGTGTCGTTTAGAAAGCGAAGGGGCGTCGTTCAGAAATCGAAGGGGCGCCTGCTCAGAAATCGAAGAGGCGTATTCAAAGATCGAAGAGGCAAAAGCCCATTTCATTCAAAGCATGTTATTGATTTGCATAACACATATTCAAGAAGAAGTTGTGTAGTGACCACCACCATATTGAGTTTTCATTCAAAAGTGAATTCTAAGTTGATTCAAATGCTTTGCTCACTATTTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

188

Amino Acids

22.02

Weight (kDa)

11.1

Isoelectric Point (pI)

59.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 375
AccII CGCG 1 cut(s) 291
AciI CCGC 1 cut(s) 314
AcsI RAATTY 1 cut(s) 523
AcvI CACGTG 2 cut(s) 210, 331
AcyI GRCGYC 2 cut(s) 354, 376
AflIII ACRYGT 4 cut(s) 93, 207, 289, 330
AgsI TTSAA 7 cut(s) 80, 135, 406, 438, 471, 516, 539
AluBI AGCT 2 cut(s) 200, 298
AluI AGCT 2 cut(s) 200, 298
AoxI GGCC 1 cut(s) 215
ApeKI GCWGC 1 cut(s) 295
ApoI RAATTY 1 cut(s) 523
AspLEI GCGC 2 cut(s) 253, 378
AspS9I GGNCC 1 cut(s) 45
AvaII GGWCC 1 cut(s) 45
BanI GGYRCC 1 cut(s) 375
BbrPI CACGTG 2 cut(s) 210, 331
BbsI GAAGAC 1 cut(s) 292
BbvI GCAGC 1 cut(s) 307
BccI CCATC 1 cut(s) 226
BclI TGATCA 1 cut(s) 127
BfoI RGCGCY 1 cut(s) 379
BisI GCNGC 2 cut(s) 296, 314
BlsI GCNGC 2 cut(s) 297, 315
Bme18I GGWCC 1 cut(s) 45
BmgT120I GGNCC 1 cut(s) 45
BmiI GGNNCC 3 cut(s) 47, 312, 377
BmsI GCATC 2 cut(s) 235, 325
BpiI GAAGAC 1 cut(s) 292
BsaAI YACGTR 2 cut(s) 210, 331
BsaHI GRCGYC 2 cut(s) 354, 376
BseMII CTCAG 1 cut(s) 397
BseXI GCAGC 1 cut(s) 307
BsgI GTGCAG 2 cut(s) 305, 314
Bsh1236I CGCG 1 cut(s) 291
BshFI GGCC 1 cut(s) 217
BshNI GGYRCC 1 cut(s) 375
BslFI GGGAC 1 cut(s) 31
BsmFI GGGAC 1 cut(s) 31
BsnI GGCC 1 cut(s) 217
Bsp143I GATC 2 cut(s) 127, 409
BspACI CCGC 1 cut(s) 314
BspANI GGCC 1 cut(s) 217
BspCNI CTCAG 1 cut(s) 396
BspFNI CGCG 1 cut(s) 291
BspLI GGNNCC 3 cut(s) 47, 312, 377
BspT107I GGYRCC 1 cut(s) 375
BssMI GATC 2 cut(s) 127, 409
BssNI GRCGYC 2 cut(s) 354, 376
Bst6I CTCTTC 2 cut(s) 388, 409
BstACI GRCGYC 2 cut(s) 354, 376
BstBAI YACGTR 2 cut(s) 210, 331
BstC8I GCNNGC 2 cut(s) 293, 380
BstDEI CTNAG 2 cut(s) 383, 528
BstFNI CGCG 1 cut(s) 291
BstH2I RGCGCY 1 cut(s) 379
BstHHI GCGC 2 cut(s) 253, 378
BstKTI GATC 2 cut(s) 130, 412
BstMBI GATC 2 cut(s) 127, 409
BstMWI GCNNNNNNNGC 3 cut(s) 223, 274, 319
BstNSI RCATGY 1 cut(s) 446
BstUI CGCG 1 cut(s) 291
BstV1I GCAGC 1 cut(s) 307
BstV2I GAAGAC 1 cut(s) 292
BsuRI GGCC 1 cut(s) 217
BtgZI GCGATG 1 cut(s) 207
Cac8I GCNNGC 2 cut(s) 293, 380
CfoI GCGC 2 cut(s) 253, 378
Cfr13I GGNCC 1 cut(s) 45
CseI GACGC 3 cut(s) 274, 297, 343
CviAII CATG 2 cut(s) 37, 443
CviJI RGCY 6 cut(s) 200, 217, 243, 298, 313, 426
CviKI_1 RGCY 6 cut(s) 200, 217, 243, 298, 313, 426
DdeI CTNAG 2 cut(s) 383, 528
DinI GGCGCC 1 cut(s) 377
DpnI GATC 2 cut(s) 129, 411
DpnII GATC 2 cut(s) 127, 409
Eam1104I CTCTTC 2 cut(s) 388, 409
EarI CTCTTC 2 cut(s) 388, 409
Eco47I GGWCC 1 cut(s) 45
Eco72I CACGTG 2 cut(s) 210, 331
EcoO109I RGGNCCY 1 cut(s) 45
EcoRI GAATTC 1 cut(s) 523
EgeI GGCGCC 1 cut(s) 377
EheI GGCGCC 1 cut(s) 377
FaeI CATG 2 cut(s) 40, 446
FaiI YATR 7 cut(s) 38, 68, 143, 444, 459, 466, 500
FaqI GGGAC 1 cut(s) 31
FatI CATG 2 cut(s) 36, 442
FbaI TGATCA 1 cut(s) 127
Fnu4HI GCNGC 2 cut(s) 296, 314
Fsp4HI GCNGC 2 cut(s) 296, 314
GlaI GCGC 2 cut(s) 252, 377
GluI GCNGC 2 cut(s) 296, 314
HaeII RGCGCY 1 cut(s) 379
HaeIII GGCC 1 cut(s) 217
HgaI GACGC 3 cut(s) 274, 297, 343
HhaI GCGC 2 cut(s) 253, 378
Hin1I GRCGYC 2 cut(s) 354, 376
Hin1II CATG 2 cut(s) 40, 446
Hin6I GCGC 2 cut(s) 251, 376
HinP1I GCGC 2 cut(s) 251, 376
HinfI GANTC 1 cut(s) 535
Hpy188I TCNGA 5 cut(s) 118, 193, 284, 363, 386
Hpy188III TCNNGA 1 cut(s) 471
Hpy99I CGWCG 2 cut(s) 268, 359
HpyAV CCTTC 2 cut(s) 342, 364
HpyCH4IV ACGT 3 cut(s) 93, 209, 330
HpyCH4V TGCA 4 cut(s) 55, 295, 322, 457
HpyF10VI GCNNNNNNNGC 3 cut(s) 223, 274, 319
HpyF3I CTNAG 2 cut(s) 383, 528
HpySE526I ACGT 3 cut(s) 93, 209, 330
Hsp92I GRCGYC 2 cut(s) 354, 376
Hsp92II CATG 2 cut(s) 40, 446
HspAI GCGC 2 cut(s) 251, 376
KasI GGCGCC 1 cut(s) 375
Ksp22I TGATCA 1 cut(s) 127
Kzo9I GATC 2 cut(s) 127, 409
LmnI GCTCC 1 cut(s) 310
LpnPI CCDG 1 cut(s) 392
Lsp1109I GCAGC 1 cut(s) 307
LweI GCATC 2 cut(s) 235, 325
MaeII ACGT 3 cut(s) 93, 209, 330
MaeIII GTNAC 2 cut(s) 27, 487
MalI GATC 2 cut(s) 129, 411
MboI GATC 2 cut(s) 127, 409
MboII GAAGA 5 cut(s) 68, 297, 405, 426, 486
MluCI AATT 3 cut(s) 112, 186, 523
MluI ACGCGT 1 cut(s) 289
Mly113I GGCGCC 1 cut(s) 376
MnlI CCTC 5 cut(s) 165, 167, 207, 389, 410
MseI TTAA 2 cut(s) 72, 562
MvnI CGCG 1 cut(s) 291
MwoI GCNNNNNNNGC 3 cut(s) 223, 274, 319
NarI GGCGCC 1 cut(s) 376
NdeII GATC 2 cut(s) 127, 409
NlaIII CATG 2 cut(s) 40, 446
NlaIV GGNNCC 3 cut(s) 47, 312, 377
NmuCI GTSAC 2 cut(s) 27, 487
NspI RCATGY 1 cut(s) 446
PfeI GAWTC 1 cut(s) 535
PkrI GCNGC 2 cut(s) 297, 315
PluTI GGCGCC 1 cut(s) 379
PmaCI CACGTG 2 cut(s) 210, 331
PmlI CACGTG 2 cut(s) 210, 331
Ppu21I YACGTR 2 cut(s) 210, 331
PpuMI RGGWCCY 1 cut(s) 45
Psp5II RGGWCCY 1 cut(s) 45
PspCI CACGTG 2 cut(s) 210, 331
PspN4I GGNNCC 3 cut(s) 47, 312, 377
PspPI GGNCC 1 cut(s) 45
PspPPI RGGWCCY 1 cut(s) 45
SaqAI TTAA 2 cut(s) 72, 562
SatI GCNGC 2 cut(s) 296, 314
Sau3AI GATC 2 cut(s) 127, 409
Sau96I GGNCC 1 cut(s) 45
SetI ASST 7 cut(s) 47, 96, 157, 202, 212, 300, 333
SfaNI GCATC 2 cut(s) 235, 325
SfoI GGCGCC 1 cut(s) 377
SinI GGWCC 1 cut(s) 45
Sse9I AATT 3 cut(s) 112, 186, 523
SsiI CCGC 1 cut(s) 314
SspDI GGCGCC 1 cut(s) 375
TaiI ACGT 3 cut(s) 96, 212, 333
TaqI TCGA 3 cut(s) 368, 391, 412
TasI AATT 3 cut(s) 112, 186, 523
TauI GCSGC 1 cut(s) 316
TfiI GAWTC 1 cut(s) 535
Tru1I TTAA 2 cut(s) 72, 562
Tru9I TTAA 2 cut(s) 72, 562
TseFI GTSAC 2 cut(s) 27, 487
TseI GCWGC 1 cut(s) 295
Tsp45I GTSAC 2 cut(s) 27, 487
TspDTI ATGAA 2 cut(s) 422, 500
VpaK11BI GGWCC 1 cut(s) 45
XapI RAATTY 1 cut(s) 523
XceI RCATGY 1 cut(s) 446
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.