Prupe.8G037200_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0000120
Physical Location & Seq
Reverse (-)
3413948 .. 3419532
5585 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G037200.1

Sequence Viewer

Length: 489 bp
ATGGATGTCCGCGTGCTGGGAACGAGGGATGACAACCGGTTAGTGAGAGATGCTATGGCACTGAGCGTGCAAAGTGTGGCATCTATCGGAAGTGTAGGGCATCGCCCCATTGCGAATTCTCATGAGGTGCAAGTTCTAAGAGCTCAATTGACGGCAGAGCAGGATTTGGTTAATGAATATCAGCGTGACATCAAAAGACTGAAAAAGGATAGGGCAAGGAAAGCAGAGGAGTACCGACACCAACTTCAAATATTGCAGGAAGAGAATGAAAAGCTATCAAAGATGGTTAGTGTTTATTCTAAAGACATGCAAAAGCAACTGGAGGCCTTGGAGAACCCAGGAAAGCACAAGCGAGATCACAAGAGGAGTTCAAGAGTGAATGATGTGATCATTAGAGGCTCAAGTGATGAGCCCCAAGTAGCGATGAGTGAAGACCCAAGAGAGGGTATCAAGAGGGCCAAACTAAAGTCTCCTGCTGTGGAAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

163

Amino Acids

18.56

Weight (kDa)

9.58

Isoelectric Point (pI)

52.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 12
AciI CCGC 1 cut(s) 10
AcsI RAATTY 1 cut(s) 115
AfaI GTAC 1 cut(s) 233
AfiI CCNNNNNNNGG 3 cut(s) 16, 442, 443
AgeI ACCGGT 1 cut(s) 36
AgsI TTSAA 2 cut(s) 248, 372
AjnI CCWGG 1 cut(s) 337
AluBI AGCT 2 cut(s) 143, 274
AluI AGCT 2 cut(s) 143, 274
Alw21I GWGCWC 1 cut(s) 145
Alw26I GTCTC 1 cut(s) 474
AoxI GGCC 2 cut(s) 324, 456
ApoI RAATTY 1 cut(s) 115
AsiGI ACCGGT 1 cut(s) 36
AspS9I GGNCC 1 cut(s) 456
BanII GRGCYC 2 cut(s) 145, 414
BbsI GAAGAC 1 cut(s) 438
Bbv12I GWGCWC 1 cut(s) 145
BccI CCATC 1 cut(s) 277
BceAI ACGGC 1 cut(s) 168
BciT130I CCWGG 1 cut(s) 339
BclI TGATCA 1 cut(s) 387
BcoDI GTCTC 1 cut(s) 474
Bme1390I CCNGG 1 cut(s) 339
BmgT120I GGNCC 1 cut(s) 456
BmrFI CCNGG 1 cut(s) 339
BmsI GCATC 3 cut(s) 40, 89, 109
BpiI GAAGAC 1 cut(s) 438
BpmI CTGGAG 1 cut(s) 341
BpuEI CTTGAG 1 cut(s) 385
BsaJI CCNNGG 2 cut(s) 327, 337
BsaWI WCCGGW 1 cut(s) 36
Bsc4I CCNNNNNNNGG 3 cut(s) 16, 442, 443
Bse118I RCCGGY 1 cut(s) 36
Bse1I ACTGG 1 cut(s) 324
Bse3DI GCAATG 1 cut(s) 108
BseBI CCWGG 1 cut(s) 339
BseDI CCNNGG 2 cut(s) 327, 337
BseGI GGATG 2 cut(s) 10, 34
BseLI CCNNNNNNNGG 3 cut(s) 16, 442, 443
BseMI GCAATG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 53
BseNI ACTGG 1 cut(s) 324
BseRI GAGGAG 2 cut(s) 242, 379
BseYI CCCAGC 1 cut(s) 16
Bsh1236I CGCG 1 cut(s) 12
BshFI GGCC 2 cut(s) 326, 458
BshTI ACCGGT 1 cut(s) 36
BsiHKAI GWGCWC 1 cut(s) 145
BsiSI CCGG 1 cut(s) 37
BslI CCNNNNNNNGG 3 cut(s) 16, 442, 443
BsmAI GTCTC 1 cut(s) 474
BsnI GGCC 2 cut(s) 326, 458
Bsp1286I GDGCHC 2 cut(s) 145, 414
Bsp143I GATC 2 cut(s) 355, 387
BspACI CCGC 1 cut(s) 10
BspANI GGCC 2 cut(s) 326, 458
BspCNI CTCAG 1 cut(s) 54
BspFNI CGCG 1 cut(s) 12
BspHI TCATGA 1 cut(s) 121
BsrDI GCAATG 1 cut(s) 108
BsrFI RCCGGY 1 cut(s) 36
BsrI ACTGG 1 cut(s) 324
BssAI RCCGGY 1 cut(s) 36
BssECI CCNNGG 2 cut(s) 327, 337
BssMI GATC 2 cut(s) 355, 387
BssT1I CCWWGG 1 cut(s) 327
Bst2UI CCWGG 1 cut(s) 339
Bst6I CTCTTC 1 cut(s) 255
BstC8I GCNNGC 2 cut(s) 14, 68
BstDEI CTNAG 2 cut(s) 62, 137
BstF5I GGATG 2 cut(s) 10, 34
BstFNI CGCG 1 cut(s) 12
BstKTI GATC 2 cut(s) 358, 390
BstMAI GTCTC 1 cut(s) 474
BstMBI GATC 2 cut(s) 355, 387
BstMWI GCNNNNNNNGC 1 cut(s) 221
BstNI CCWGG 1 cut(s) 339
BstNSI RCATGY 1 cut(s) 310
BstSCI CCNGG 1 cut(s) 337
BstUI CGCG 1 cut(s) 12
BstV2I GAAGAC 1 cut(s) 438
BsuRI GGCC 2 cut(s) 326, 458
BtgZI GCGATG 2 cut(s) 86, 437
BtsCI GGATG 2 cut(s) 10, 34
BtsIMutI CAGTG 1 cut(s) 59
Cac8I GCNNGC 2 cut(s) 14, 68
CciI TCATGA 1 cut(s) 121
Cfr10I RCCGGY 1 cut(s) 36
Cfr13I GGNCC 1 cut(s) 456
Csp6I GTAC 1 cut(s) 232
CspAI ACCGGT 1 cut(s) 36
CviAII CATG 2 cut(s) 122, 307
CviJI RGCY 6 cut(s) 143, 274, 326, 399, 412, 458
CviKI_1 RGCY 6 cut(s) 143, 274, 326, 399, 412, 458
CviQI GTAC 1 cut(s) 232
DdeI CTNAG 2 cut(s) 62, 137
DpnI GATC 2 cut(s) 357, 389
DpnII GATC 2 cut(s) 355, 387
Eam1104I CTCTTC 1 cut(s) 255
EarI CTCTTC 1 cut(s) 255
Ecl136II GAGCTC 1 cut(s) 143
Eco130I CCWWGG 1 cut(s) 327
Eco147I AGGCCT 1 cut(s) 326
Eco24I GRGCYC 2 cut(s) 145, 414
Eco53kI GAGCTC 1 cut(s) 143
EcoICRI GAGCTC 1 cut(s) 143
EcoRI GAATTC 1 cut(s) 115
EcoRII CCWGG 1 cut(s) 337
EcoT14I CCWWGG 1 cut(s) 327
EcoT38I GRGCYC 2 cut(s) 145, 414
ErhI CCWWGG 1 cut(s) 327
FaeI CATG 2 cut(s) 125, 310
FaiI YATR 3 cut(s) 56, 123, 308
FatI CATG 2 cut(s) 121, 306
FbaI TGATCA 1 cut(s) 387
FokI GGATG 2 cut(s) 17, 41
FriOI GRGCYC 2 cut(s) 145, 414
GsaI CCCAGC 1 cut(s) 20
GsuI CTGGAG 1 cut(s) 341
HaeIII GGCC 2 cut(s) 326, 458
HapII CCGG 1 cut(s) 37
Hin1II CATG 2 cut(s) 125, 310
HpaII CCGG 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 89
Hpy188III TCNNGA 3 cut(s) 122, 372, 451
HpyCH4V TGCA 4 cut(s) 70, 130, 256, 310
HpyF10VI GCNNNNNNNGC 1 cut(s) 221
HpyF3I CTNAG 2 cut(s) 62, 137
Hsp92II CATG 2 cut(s) 125, 310
Ksp22I TGATCA 1 cut(s) 387
Kzo9I GATC 2 cut(s) 355, 387
LpnPI CCDG 7 cut(s) 2, 50, 146, 242, 305, 324, 351
LweI GCATC 3 cut(s) 40, 89, 109
MaeIII GTNAC 1 cut(s) 185
MalI GATC 2 cut(s) 357, 389
MboI GATC 2 cut(s) 355, 387
MboII GAAGA 2 cut(s) 272, 443
MfeI CAATTG 1 cut(s) 146
MhlI GDGCHC 2 cut(s) 145, 414
MluCI AATT 2 cut(s) 115, 146
MnlI CCTC 8 cut(s) 18, 118, 220, 316, 357, 389, 436, 447
MseI TTAA 1 cut(s) 171
MspI CCGG 1 cut(s) 37
MspR9I CCNGG 1 cut(s) 339
MunI CAATTG 1 cut(s) 146
MvaI CCWGG 1 cut(s) 339
MvnI CGCG 1 cut(s) 12
MwoI GCNNNNNNNGC 1 cut(s) 221
NdeII GATC 2 cut(s) 355, 387
NlaIII CATG 2 cut(s) 125, 310
NmuCI GTSAC 1 cut(s) 185
NspI RCATGY 1 cut(s) 310
PagI TCATGA 1 cut(s) 121
PceI AGGCCT 1 cut(s) 326
PinAI ACCGGT 1 cut(s) 36
Psp124BI GAGCTC 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 337
PspFI CCCAGC 1 cut(s) 16
PspGI CCWGG 1 cut(s) 337
PspPI GGNCC 1 cut(s) 456
RsaI GTAC 1 cut(s) 233
RsaNI GTAC 1 cut(s) 232
SacI GAGCTC 1 cut(s) 145
SaqAI TTAA 1 cut(s) 171
Sau3AI GATC 2 cut(s) 355, 387
Sau96I GGNCC 1 cut(s) 456
ScrFI CCNGG 1 cut(s) 339
SduI GDGCHC 2 cut(s) 145, 414
SetI ASST 3 cut(s) 129, 145, 276
SfaNI GCATC 3 cut(s) 40, 89, 109
SmlI CTYRAG 1 cut(s) 400
SmoI CTYRAG 1 cut(s) 400
Sse9I AATT 2 cut(s) 115, 146
SseBI AGGCCT 1 cut(s) 326
SsiI CCGC 1 cut(s) 10
SspI AATATT 1 cut(s) 252
SstI GAGCTC 1 cut(s) 145
StuI AGGCCT 1 cut(s) 326
StyD4I CCNGG 1 cut(s) 337
StyI CCWWGG 1 cut(s) 327
TasI AATT 2 cut(s) 115, 146
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TscAI CASTG 1 cut(s) 66
TseFI GTSAC 1 cut(s) 185
Tsp45I GTSAC 1 cut(s) 185
TspDTI ATGAA 2 cut(s) 189, 282
TspRI CASTG 1 cut(s) 66
XapI RAATTY 1 cut(s) 115
XceI RCATGY 1 cut(s) 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.