Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr01

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

27874620 .. 27878683

Gene Structure 4064 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD01G1178800.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 801 bp

ATGAATCCTAGAACGCCATTGCGCTCGGTTTTGTGTCATGTCCTCCTGGGAGCTGCAAGTTTCACGTGCTCAACTTTGGCAGAGAACTTTGGCAAAGTTATCTGTGGTACCCATGAGCTATTGTTGCGTGCAGTCCCGCCTTCTCCAGACAACATATGGCGCCCATCCTTCGTCTCCCCTACTGGTCCTCTTACCGTTGGGGATTCCGTGATGAAGAATGATATGACCGCTGCGGTGGTGGCCAGGAACCTTCTCACTCCCAAAGATAACAGACTACTTTCCAAACGGTCTGATGAGTTAGCTGTTAAGGATTCGCTGGCTCTCAGTGTTCAGTGTGCAAGTTCTGTGTCTAATATGGCCCAACGCCTATTTGCTCGAACCCGCCAAGTTGAATCATTGGCGGCTGAAGTGATGAGTCTCAAACAAGAGATTAGAGGGCTCAAGCATGAGAATAAACAGTTGCACCGGCTCGCACATGACTATGCTACAAACATGAAGAGGAAGCTTAACCAGATGAAGGAAACTGATGGTCAGGTTTTACTTGATCATCAGAGATTTGTGGGTTTGTTCCAAAGGCATTTATTGCCTTCGTCTTCTGGGGCTGTACCGCGTAATGAAGCTCCAAATGATCAACCTCTGATGCCTCCTCCTTCTAGGGTTCTGTCCAGTACTGAGGCTCCAAATGATCCCCCTCCGGTGCCTTCTCTTTCTGGGGCTCTACCGACTGCTGAGACTTCTCCTAAGCAACCTTTCTTGTATGTTGAAGCTTGTATGTTGAAGCTTTCTGAGTGGAGCATGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

267

Amino Acids

29.21

Weight (kDa)

9.18

Isoelectric Point (pI)

53.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	107
AccB1I	GGYRCC	3 cut(s)	107, 159, 697
AccII	CGCG	1 cut(s)	610
AciI	CCGC	6 cut(s)	137, 228, 233, 382, 401, 608
AclWI	GGATC	1 cut(s)	680
AcoI	YGGCCR	1 cut(s)	240
AcuI	CTGAAG	1 cut(s)	426
AcvI	CACGTG	1 cut(s)	66
AcyI	GRCGYC	1 cut(s)	160
AfaI	GTAC	3 cut(s)	109, 606, 670
AfiI	CCNNNNNNNGG	1 cut(s)	517
AgsI	TTSAA	3 cut(s)	392, 764, 778
AjnI	CCWGG	2 cut(s)	45, 242
AluBI	AGCT	7 cut(s)	53, 118, 302, 505, 620, 767, 781
AluI	AGCT	7 cut(s)	53, 118, 302, 505, 620, 767, 781
Alw21I	GWGCWC	1 cut(s)	71
Alw26I	GTCTC	3 cut(s)	178, 422, 725
AlwI	GGATC	1 cut(s)	680
AoxI	GGCC	2 cut(s)	240, 357
ApeKI	GCWGC	2 cut(s)	53, 230
Asp718I	GGTACC	1 cut(s)	107
AspLEI	GCGC	2 cut(s)	24, 162
AspS9I	GGNCC	2 cut(s)	185, 358
AvaII	GGWCC	1 cut(s)	185
BalI	TGGCCA	1 cut(s)	242
BanI	GGYRCC	3 cut(s)	107, 159, 697
BanII	GRGCYC	2 cut(s)	441, 718
BbrPI	CACGTG	1 cut(s)	66
BbsI	GAAGAC	1 cut(s)	585
Bbv12I	GWGCWC	1 cut(s)	71
BbvI	GCAGC	2 cut(s)	40, 217
BccI	CCATC	2 cut(s)	172, 521
BciT130I	CCWGG	2 cut(s)	47, 244
BclI	TGATCA	2 cut(s)	544, 628
BcoDI	GTCTC	3 cut(s)	178, 422, 725
BfaI	CTAG	2 cut(s)	9, 654
BfoI	RGCGCY	1 cut(s)	163
BisI	GCNGC	3 cut(s)	54, 231, 402
BlsI	GCNGC	3 cut(s)	55, 232, 403
BmcAI	AGTACT	1 cut(s)	670
Bme1390I	CCNGG	2 cut(s)	47, 244
Bme18I	GGWCC	1 cut(s)	185
BmgT120I	GGNCC	2 cut(s)	185, 358
BmiI	GGNNCC	5 cut(s)	109, 161, 248, 678, 699
BmrFI	CCNGG	2 cut(s)	47, 244
BmsI	GCATC	1 cut(s)	630
BpiI	GAAGAC	1 cut(s)	585
BpmI	CTGGAG	1 cut(s)	129
Bpu10I	CCTNAGC	1 cut(s)	741
BpuEI	CTTGAG	1 cut(s)	425
BsaAI	YACGTR	1 cut(s)	66
BsaHI	GRCGYC	1 cut(s)	160
BsaJI	CCNNGG	1 cut(s)	46
BsaWI	WCCGGW	1 cut(s)	694
BsaXI	ACNNNNNCTCC	2 cut(s)	661, 691
Bsc4I	CCNNNNNNNGG	1 cut(s)	517
Bse118I	RCCGGY	1 cut(s)	465
Bse1I	ACTGG	2 cut(s)	187, 666
Bse3DI	GCAATG	1 cut(s)	17
BseBI	CCWGG	2 cut(s)	47, 244
BseDI	CCNNGG	1 cut(s)	46
BseGI	GGATG	1 cut(s)	164
BseLI	CCNNNNNNNGG	1 cut(s)	517
BseMI	GCAATG	1 cut(s)	17
BseMII	CTCAG	4 cut(s)	337, 663, 720, 777
BseNI	ACTGG	2 cut(s)	187, 666
BseRI	GAGGAG	1 cut(s)	636
BseXI	GCAGC	2 cut(s)	40, 217
BsgI	GTGCAG	1 cut(s)	150
Bsh1236I	CGCG	1 cut(s)	610
BshFI	GGCC	2 cut(s)	242, 359
BshNI	GGYRCC	3 cut(s)	107, 159, 697
BsiHKAI	GWGCWC	1 cut(s)	71
BsiSI	CCGG	2 cut(s)	466, 695
BslFI	GGGAC	1 cut(s)	119
BslI	CCNNNNNNNGG	1 cut(s)	517
BsmAI	GTCTC	3 cut(s)	178, 422, 725
BsmBI	CGTCTC	1 cut(s)	178
BsmFI	GGGAC	1 cut(s)	119
BsnI	GGCC	2 cut(s)	242, 359
Bsp1286I	GDGCHC	3 cut(s)	71, 441, 718
Bsp143I	GATC	3 cut(s)	544, 628, 685
BspACI	CCGC	6 cut(s)	137, 228, 233, 382, 401, 608
BspANI	GGCC	2 cut(s)	242, 359
BspCNI	CTCAG	4 cut(s)	336, 664, 721, 778
BspFNI	CGCG	1 cut(s)	610
BspLI	GGNNCC	5 cut(s)	109, 161, 248, 678, 699
BspPI	GGATC	1 cut(s)	680
BspT107I	GGYRCC	3 cut(s)	107, 159, 697
BsrDI	GCAATG	1 cut(s)	17
BsrFI	RCCGGY	1 cut(s)	465
BsrI	ACTGG	2 cut(s)	187, 666
BssAI	RCCGGY	1 cut(s)	465
BssECI	CCNNGG	1 cut(s)	46
BssMI	GATC	3 cut(s)	544, 628, 685
BssNI	GRCGYC	1 cut(s)	160
Bst2UI	CCWGG	2 cut(s)	47, 244
Bst4CI	ACNGT	3 cut(s)	196, 288, 459
Bst6I	CTCTTC	1 cut(s)	491
BstACI	GRCGYC	1 cut(s)	160
BstAPI	GCANNNNNTGC	1 cut(s)	583
BstBAI	YACGTR	1 cut(s)	66
BstC8I	GCNNGC	3 cut(s)	129, 318, 471
BstDEI	CTNAG	5 cut(s)	323, 672, 729, 741, 786
BstF5I	GGATG	1 cut(s)	164
BstFNI	CGCG	1 cut(s)	610
BstH2I	RGCGCY	1 cut(s)	163
BstHHI	GCGC	2 cut(s)	24, 162
BstKTI	GATC	3 cut(s)	547, 631, 688
BstMAI	GTCTC	3 cut(s)	178, 422, 725
BstMBI	GATC	3 cut(s)	544, 628, 685
BstMWI	GCNNNNNNNGC	3 cut(s)	124, 239, 583
BstNI	CCWGG	2 cut(s)	47, 244
BstNSI	RCATGY	1 cut(s)	799
BstSCI	CCNGG	2 cut(s)	45, 242
BstUI	CGCG	1 cut(s)	610
BstV1I	GCAGC	2 cut(s)	40, 217
BstV2I	GAAGAC	1 cut(s)	585
BsuRI	GGCC	2 cut(s)	242, 359
BtsCI	GGATG	1 cut(s)	164
BtsIMutI	CAGTG	2 cut(s)	331, 338
Cac8I	GCNNGC	3 cut(s)	129, 318, 471
CfoI	GCGC	2 cut(s)	24, 162
Cfr10I	RCCGGY	1 cut(s)	465
Cfr13I	GGNCC	2 cut(s)	185, 358
Csp6I	GTAC	3 cut(s)	108, 605, 669
CviAII	CATG	6 cut(s)	38, 113, 446, 476, 493, 796
CviQI	GTAC	3 cut(s)	108, 605, 669
DdeI	CTNAG	5 cut(s)	323, 672, 729, 741, 786
DinI	GGCGCC	1 cut(s)	161
DpnI	GATC	3 cut(s)	546, 630, 687
DpnII	GATC	3 cut(s)	544, 628, 685
EaeI	YGGCCR	1 cut(s)	240
Eam1104I	CTCTTC	1 cut(s)	491
EarI	CTCTTC	1 cut(s)	491
Eco24I	GRGCYC	2 cut(s)	441, 718
Eco47I	GGWCC	1 cut(s)	185
Eco57I	CTGAAG	1 cut(s)	426
Eco72I	CACGTG	1 cut(s)	66
EcoRII	CCWGG	2 cut(s)	45, 242
EcoT38I	GRGCYC	2 cut(s)	441, 718
EgeI	GGCGCC	1 cut(s)	161
EheI	GGCGCC	1 cut(s)	161
Esp3I	CGTCTC	1 cut(s)	178
FaeI	CATG	6 cut(s)	41, 116, 449, 479, 496, 799
FaqI	GGGAC	1 cut(s)	119
FatI	CATG	6 cut(s)	37, 112, 445, 475, 492, 795
FauI	CCCGC	2 cut(s)	144, 389
FauNDI	CATATG	1 cut(s)	155
FbaI	TGATCA	2 cut(s)	544, 628
Fnu4HI	GCNGC	3 cut(s)	54, 231, 402
FokI	GGATG	1 cut(s)	151
FriOI	GRGCYC	2 cut(s)	441, 718
Fsp4HI	GCNGC	3 cut(s)	54, 231, 402
FspBI	CTAG	2 cut(s)	9, 654
GlaI	GCGC	2 cut(s)	23, 161
GluI	GCNGC	3 cut(s)	54, 231, 402
GsuI	CTGGAG	1 cut(s)	129
HaeII	RGCGCY	1 cut(s)	163
HaeIII	GGCC	2 cut(s)	242, 359
HapII	CCGG	2 cut(s)	466, 695
HhaI	GCGC	2 cut(s)	24, 162
Hin1I	GRCGYC	1 cut(s)	160
Hin1II	CATG	6 cut(s)	41, 116, 449, 479, 496, 799
Hin6I	GCGC	2 cut(s)	22, 160
HinP1I	GCGC	2 cut(s)	22, 160
HindIII	AAGCTT	3 cut(s)	503, 765, 779
HinfI	GANTC	5 cut(s)	4, 203, 311, 392, 415
HpaII	CCGG	2 cut(s)	466, 695
Hpy188I	TCNGA	4 cut(s)	292, 552, 639, 787
Hpy188III	TCNNGA	1 cut(s)	146
HpyAV	CCTTC	7 cut(s)	150, 178, 260, 511, 597, 660, 711
HpyCH4III	ACNGT	3 cut(s)	196, 288, 459
HpyCH4IV	ACGT	1 cut(s)	65
HpyCH4V	TGCA	4 cut(s)	56, 131, 338, 463
HpyF10VI	GCNNNNNNNGC	3 cut(s)	124, 239, 583
HpyF3I	CTNAG	5 cut(s)	323, 672, 729, 741, 786
HpySE526I	ACGT	1 cut(s)	65
Hsp92I	GRCGYC	1 cut(s)	160
Hsp92II	CATG	6 cut(s)	41, 116, 449, 479, 496, 799
HspAI	GCGC	2 cut(s)	22, 160
KasI	GGCGCC	1 cut(s)	159
KpnI	GGTACC	1 cut(s)	111
Ksp22I	TGATCA	2 cut(s)	544, 628
Kzo9I	GATC	3 cut(s)	544, 628, 685
LmnI	GCTCC	4 cut(s)	50, 625, 682, 792
Lsp1109I	GCAGC	2 cut(s)	40, 217
LweI	GCATC	1 cut(s)	630
MaeI	CTAG	2 cut(s)	9, 654
MaeII	ACGT	1 cut(s)	65
MalI	GATC	3 cut(s)	546, 630, 687
MboI	GATC	3 cut(s)	544, 628, 685
MboII	GAAGA	3 cut(s)	226, 508, 585
MhlI	GDGCHC	3 cut(s)	71, 441, 718
MlsI	TGGCCA	1 cut(s)	242
MluNI	TGGCCA	1 cut(s)	242
Mly113I	GGCGCC	1 cut(s)	160
MlyI	GAGTC	1 cut(s)	424
MnlI	CCTC	9 cut(s)	53, 198, 428, 492, 645, 654, 657, 667, 702
Mox20I	TGGCCA	1 cut(s)	242
MscI	TGGCCA	1 cut(s)	242
MseI	TTAA	2 cut(s)	306, 507
MslI	CAYNNNNRTG	1 cut(s)	480
Msp20I	TGGCCA	1 cut(s)	242
MspA1I	CMGCKG	1 cut(s)	230
MspI	CCGG	2 cut(s)	466, 695
MspR9I	CCNGG	2 cut(s)	47, 244
MvaI	CCWGG	2 cut(s)	47, 244
MvnI	CGCG	1 cut(s)	610
MwoI	GCNNNNNNNGC	3 cut(s)	124, 239, 583
NarI	GGCGCC	1 cut(s)	160
NdeI	CATATG	1 cut(s)	155
NdeII	GATC	3 cut(s)	544, 628, 685
NlaIII	CATG	6 cut(s)	41, 116, 449, 479, 496, 799
NlaIV	GGNNCC	5 cut(s)	109, 161, 248, 678, 699
NspI	RCATGY	1 cut(s)	799
PfeI	GAWTC	4 cut(s)	4, 203, 311, 392
PkrI	GCNGC	3 cut(s)	55, 232, 403
PleI	GAGTC	1 cut(s)	423
PluTI	GGCGCC	1 cut(s)	163
PmaCI	CACGTG	1 cut(s)	66
PmlI	CACGTG	1 cut(s)	66
PpsI	GAGTC	1 cut(s)	423
Ppu21I	YACGTR	1 cut(s)	66
Psp6I	CCWGG	2 cut(s)	45, 242
PspCI	CACGTG	1 cut(s)	66
PspGI	CCWGG	2 cut(s)	45, 242
PspN4I	GGNNCC	5 cut(s)	109, 161, 248, 678, 699
PspPI	GGNCC	2 cut(s)	185, 358
RsaI	GTAC	3 cut(s)	109, 606, 670
RsaNI	GTAC	3 cut(s)	108, 605, 669
RseI	CAYNNNNRTG	1 cut(s)	480
SaqAI	TTAA	2 cut(s)	306, 507
SatI	GCNGC	3 cut(s)	54, 231, 402
Sau3AI	GATC	3 cut(s)	544, 628, 685
Sau96I	GGNCC	2 cut(s)	185, 358
ScaI	AGTACT	1 cut(s)	670
SchI	GAGTC	1 cut(s)	424
ScrFI	CCNGG	2 cut(s)	47, 244
SduI	GDGCHC	3 cut(s)	71, 441, 718
SfaNI	GCATC	1 cut(s)	630
SfoI	GGCGCC	1 cut(s)	161
SinI	GGWCC	1 cut(s)	185
SmiMI	CAYNNNNRTG	1 cut(s)	480
SmlI	CTYRAG	1 cut(s)	440
SmoI	CTYRAG	1 cut(s)	440
SsiI	CCGC	6 cut(s)	137, 228, 233, 382, 401, 608
SspDI	GGCGCC	1 cut(s)	159
SspMI	CTAG	2 cut(s)	9, 654
StyD4I	CCNGG	2 cut(s)	45, 242
TaaI	ACNGT	3 cut(s)	196, 288, 459
TaiI	ACGT	1 cut(s)	68
TaqI	TCGA	1 cut(s)	376
TatI	WGTACW	1 cut(s)	668
TauI	GCSGC	1 cut(s)	404
TfiI	GAWTC	4 cut(s)	4, 203, 311, 392
Tru1I	TTAA	2 cut(s)	306, 507
Tru9I	TTAA	2 cut(s)	306, 507
TscAI	CASTG	2 cut(s)	331, 338
TseI	GCWGC	2 cut(s)	53, 230
TspDTI	ATGAA	5 cut(s)	17, 227, 509, 530, 630
TspGWI	ACGGA	1 cut(s)	196
TspRI	CASTG	2 cut(s)	331, 338
VpaK11BI	GGWCC	1 cut(s)	185
XceI	RCATGY	1 cut(s)	799
XcmI	CCANNNNNNNNNTGG	1 cut(s)	153
XspI	CTAG	2 cut(s)	9, 654
ZrmI	AGTACT	1 cut(s)	670

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.