Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00000808

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

394708 .. 398718

Gene Structure 4011 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom808g00640.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 846 bp

ATGGATAAGCTATCCAATCCATGCCCAAAAATGCTCCAAATGGCCTCAAAATGCACTTACTTGCTCCCTAGGCCCTTAGAACCTGAAAACACACAAAAGAAGCACGAGAACAATGCATGTGAAGTCATACATTATAACCATAACCAAGCATATACCAAGATCATGCAATTACAAACCAAATCCTTATCATTGTGTTGGAAGAAACAACATGTGAAAGCAACGCTAGGTAAGCAATCAGGAATAGATTCCAGGCAGTTGGCTCCAGAACGGAAGACTGACTCCAAGTGCCGGCTGATTGCTTCTTTTACTTTGCCATCTACAATAGTAGCTAGGAACCTCCTCACTCCGAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTCAAGCAGGAGATCCAGCAGCTGAAGTATGAGAATAGAAGTTTGCATGTGCTTGCAAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGTTGCAAGAGTCTGAAGGTCGGATTCACAGTGACCGTCAAAGGTTTTCGTTTTTCCTCCAGAGGTACCTTTTTCCTGGCTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTATCTTCGATGCCTCCCGCTCCGATGCCTTCTGTTCCTACGCCTTCCGCTCCGATGCCCTCTGTTCCTACGCCTTCCGCTTCAAGAGTAAAGCCACGTAGTGGGGCCTCAAGCAAACAACCTTTATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

282

Amino Acids

31.43

Weight (kDa)

9.71

Isoelectric Point (pI)

67.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	135
Acc65I	GGTACC	1 cut(s)	663
AccB1I	GGYRCC	1 cut(s)	663
AccB7I	CCANNNNNTGG	2 cut(s)	690, 818
AccBSI	CCGCTC	3 cut(s)	465, 737, 767
AciI	CCGC	4 cut(s)	463, 735, 765, 795
AclWI	GGATC	1 cut(s)	511
AcoI	YGGCCR	2 cut(s)	387, 692
AcuI	CTGAAG	2 cut(s)	548, 633
AdeI	CACNNNGTG	2 cut(s)	413, 818
AfaI	GTAC	1 cut(s)	665
AfeI	AGCGCT	1 cut(s)	688
AfiI	CCNNNNNNNGG	4 cut(s)	288, 475, 690, 818
AflIII	ACRYGT	1 cut(s)	208
AgsI	TTSAA	2 cut(s)	395, 801
AjnI	CCWGG	3 cut(s)	248, 673, 707
AluBI	AGCT	4 cut(s)	10, 329, 526, 592
AluI	AGCT	4 cut(s)	10, 329, 526, 592
Alw26I	GTCTC	1 cut(s)	509
AlwI	GGATC	1 cut(s)	511
AlwNI	CAGNNNCTG	1 cut(s)	526
Aor51HI	AGCGCT	1 cut(s)	688
AoxI	GGCC	7 cut(s)	42, 71, 387, 445, 692, 705, 822
ApeKI	GCWGC	2 cut(s)	361, 523
Asp700I	GAANNNNTTC	1 cut(s)	244
Asp718I	GGTACC	1 cut(s)	663
AspA2I	CCTAGG	1 cut(s)	68
AspLEI	GCGC	1 cut(s)	689
AspS9I	GGNCC	4 cut(s)	72, 375, 445, 822
AvaII	GGWCC	1 cut(s)	375
AvrII	CCTAGG	1 cut(s)	68
BalI	TGGCCA	1 cut(s)	694
BanI	GGYRCC	1 cut(s)	663
BauI	CACGAG	1 cut(s)	104
BbsI	GAAGAC	1 cut(s)	278
BbvI	GCAGC	2 cut(s)	348, 535
BccI	CCATC	2 cut(s)	322, 481
BceAI	ACGGC	1 cut(s)	374
BcgI	CGANNNNNNTGC	2 cut(s)	95, 129
BciT130I	CCWGG	3 cut(s)	250, 675, 709
BcoDI	GTCTC	1 cut(s)	509
BfaI	CTAG	3 cut(s)	69, 224, 330
BfoI	RGCGCY	1 cut(s)	690
BisI	GCNGC	2 cut(s)	362, 524
BlnI	CCTAGG	1 cut(s)	68
BlsI	GCNGC	2 cut(s)	363, 525
Bme1390I	CCNGG	3 cut(s)	250, 675, 709
Bme18I	GGWCC	1 cut(s)	375
BmgT120I	GGNCC	4 cut(s)	72, 375, 445, 822
BmiI	GGNNCC	4 cut(s)	261, 335, 665, 823
BmrFI	CCNGG	3 cut(s)	250, 675, 709
BmsI	GCATC	3 cut(s)	717, 732, 762
BpiI	GAAGAC	1 cut(s)	278
BpmI	CTGGAG	2 cut(s)	246, 641
BpuEI	CTTGAG	2 cut(s)	491, 811
BsaAI	YACGTR	1 cut(s)	815
BsaJI	CCNNGG	1 cut(s)	68
Bsc4I	CCNNNNNNNGG	4 cut(s)	288, 475, 690, 818
Bse118I	RCCGGY	1 cut(s)	288
BseBI	CCWGG	3 cut(s)	250, 675, 709
BseDI	CCNNGG	1 cut(s)	68
BseGI	GGATG	1 cut(s)	680
BseLI	CCNNNNNNNGG	4 cut(s)	288, 475, 690, 818
BseRI	GAGGAG	1 cut(s)	329
BseXI	GCAGC	2 cut(s)	348, 535
BshFI	GGCC	7 cut(s)	44, 73, 389, 447, 694, 707, 824
BshNI	GGYRCC	1 cut(s)	663
BsiSI	CCGG	1 cut(s)	289
BslFI	GGGAC	1 cut(s)	385
BslI	CCNNNNNNNGG	4 cut(s)	288, 475, 690, 818
BsmAI	GTCTC	1 cut(s)	509
BsmFI	GGGAC	1 cut(s)	385
BsmI	GAATGC	1 cut(s)	718
BsnI	GGCC	7 cut(s)	44, 73, 389, 447, 694, 707, 824
Bsp143I	GATC	2 cut(s)	159, 516
BspACI	CCGC	4 cut(s)	463, 735, 765, 795
BspANI	GGCC	7 cut(s)	44, 73, 389, 447, 694, 707, 824
BspLI	GGNNCC	4 cut(s)	261, 335, 665, 823
BspPI	GGATC	1 cut(s)	511
BspT107I	GGYRCC	1 cut(s)	663
BsrBI	CCGCTC	3 cut(s)	465, 737, 767
BsrFI	RCCGGY	1 cut(s)	288
BssAI	RCCGGY	1 cut(s)	288
BssECI	CCNNGG	1 cut(s)	68
BssMI	GATC	2 cut(s)	159, 516
BssSI	CACGAG	1 cut(s)	104
BssT1I	CCWWGG	1 cut(s)	68
Bst2BI	CACGAG	1 cut(s)	104
Bst2UI	CCWGG	3 cut(s)	250, 675, 709
Bst4CI	ACNGT	3 cut(s)	375, 629, 635
Bst6I	CTCTTC	1 cut(s)	578
BstBAI	YACGTR	1 cut(s)	815
BstC8I	GCNNGC	5 cut(s)	290, 455, 459, 463, 558
BstDEI	CTNAG	2 cut(s)	76, 410
BstF5I	GGATG	1 cut(s)	680
BstH2I	RGCGCY	1 cut(s)	690
BstHHI	GCGC	1 cut(s)	689
BstKTI	GATC	2 cut(s)	162, 519
BstMAI	GTCTC	1 cut(s)	509
BstMBI	GATC	2 cut(s)	159, 516
BstMWI	GCNNNNNNNGC	4 cut(s)	70, 229, 684, 713
BstNI	CCWGG	3 cut(s)	250, 675, 709
BstNSI	RCATGY	3 cut(s)	120, 212, 554
BstSCI	CCNGG	3 cut(s)	248, 673, 707
BstV1I	GCAGC	2 cut(s)	348, 535
BstV2I	GAAGAC	1 cut(s)	278
BstX2I	RGATCY	1 cut(s)	516
BstXI	CCANNNNNNTGG	1 cut(s)	256
BstYI	RGATCY	1 cut(s)	516
BsuRI	GGCC	7 cut(s)	44, 73, 389, 447, 694, 707, 824
BtsCI	GGATG	1 cut(s)	680
BtsIMutI	CAGTG	2 cut(s)	425, 634
Cac8I	GCNNGC	5 cut(s)	290, 455, 459, 463, 558
CaiI	CAGNNNCTG	1 cut(s)	526
CfoI	GCGC	1 cut(s)	689
Cfr10I	RCCGGY	1 cut(s)	288
Cfr13I	GGNCC	4 cut(s)	72, 375, 445, 822
CpoI	CGGWCCG	1 cut(s)	375
Csp6I	GTAC	1 cut(s)	664
CspI	CGGWCCG	1 cut(s)	375
CviAII	CATG	7 cut(s)	21, 117, 163, 209, 442, 551, 580
CviQI	GTAC	1 cut(s)	664
DdeI	CTNAG	2 cut(s)	76, 410
DpnI	GATC	2 cut(s)	161, 518
DpnII	GATC	2 cut(s)	159, 516
DraIII	CACNNNGTG	2 cut(s)	413, 818
EaeI	YGGCCR	2 cut(s)	387, 692
Eam1104I	CTCTTC	1 cut(s)	578
EarI	CTCTTC	1 cut(s)	578
Eco130I	CCWWGG	1 cut(s)	68
Eco147I	AGGCCT	1 cut(s)	707
Eco47I	GGWCC	1 cut(s)	375
Eco47III	AGCGCT	1 cut(s)	688
Eco57I	CTGAAG	2 cut(s)	548, 633
EcoO109I	RGGNCCY	2 cut(s)	72, 822
EcoRII	CCWGG	3 cut(s)	248, 673, 707
EcoT14I	CCWWGG	1 cut(s)	68
EcoT22I	ATGCAT	1 cut(s)	118
ErhI	CCWWGG	1 cut(s)	68
FaeI	CATG	7 cut(s)	24, 120, 166, 212, 445, 554, 583
FaqI	GGGAC	1 cut(s)	385
FatI	CATG	7 cut(s)	20, 116, 162, 208, 441, 550, 579
FauI	CCCGC	2 cut(s)	470, 742
Fnu4HI	GCNGC	2 cut(s)	362, 524
FokI	GGATG	1 cut(s)	667
Fsp4HI	GCNGC	2 cut(s)	362, 524
FspBI	CTAG	3 cut(s)	69, 224, 330
GlaI	GCGC	1 cut(s)	688
GluI	GCNGC	2 cut(s)	362, 524
GsuI	CTGGAG	2 cut(s)	246, 641
HaeII	RGCGCY	1 cut(s)	690
HaeIII	GGCC	7 cut(s)	44, 73, 389, 447, 694, 707, 824
HapII	CCGG	1 cut(s)	289
HhaI	GCGC	1 cut(s)	689
Hin1II	CATG	7 cut(s)	24, 120, 166, 212, 445, 554, 583
Hin6I	GCGC	1 cut(s)	687
HinP1I	GCGC	1 cut(s)	687
HindIII	AAGCTT	1 cut(s)	590
HinfI	GANTC	6 cut(s)	245, 278, 398, 479, 608, 622
HpaII	CCGG	1 cut(s)	289
Hpy188I	TCNGA	6 cut(s)	348, 379, 613, 621, 741, 771
Hpy188III	TCNNGA	6 cut(s)	237, 263, 369, 395, 658, 801
Hpy99I	CGWCG	1 cut(s)	577
HpyAV	CCTTC	4 cut(s)	608, 756, 771, 801
HpyCH4III	ACNGT	3 cut(s)	375, 629, 635
HpyCH4IV	ACGT	1 cut(s)	814
HpyCH4V	TGCA	6 cut(s)	54, 116, 166, 550, 560, 604
HpyF10VI	GCNNNNNNNGC	4 cut(s)	70, 229, 684, 713
HpyF3I	CTNAG	2 cut(s)	76, 410
HpySE526I	ACGT	1 cut(s)	814
Hsp92II	CATG	7 cut(s)	24, 120, 166, 212, 445, 554, 583
HspAI	GCGC	1 cut(s)	687
KpnI	GGTACC	1 cut(s)	667
KroI	GCCGGC	1 cut(s)	288
KroNI	GCCGGC	1 cut(s)	290
Kzo9I	GATC	2 cut(s)	159, 516
LmnI	GCTCC	6 cut(s)	39, 69, 265, 470, 742, 772
Lsp1109I	GCAGC	2 cut(s)	348, 535
LweI	GCATC	3 cut(s)	717, 732, 762
MaeI	CTAG	3 cut(s)	69, 224, 330
MaeII	ACGT	1 cut(s)	814
MaeIII	GTNAC	1 cut(s)	629
MalI	GATC	2 cut(s)	161, 518
MbiI	CCGCTC	3 cut(s)	465, 737, 767
MboI	GATC	2 cut(s)	159, 516
MboII	GAAGA	4 cut(s)	211, 283, 595, 714
MflI	RGATCY	1 cut(s)	516
MlsI	TGGCCA	1 cut(s)	694
MluCI	AATT	1 cut(s)	167
MluNI	TGGCCA	1 cut(s)	694
MlyI	GAGTC	3 cut(s)	272, 407, 617
MmeI	TCCRAC	3 cut(s)	176, 462, 599
Mox20I	TGGCCA	1 cut(s)	694
Mph1103I	ATGCAT	1 cut(s)	118
MroNI	GCCGGC	1 cut(s)	288
MroXI	GAANNNNTTC	1 cut(s)	244
MscI	TGGCCA	1 cut(s)	694
Msp20I	TGGCCA	1 cut(s)	694
MspA1I	CMGCKG	1 cut(s)	526
MspI	CCGG	1 cut(s)	289
MspR9I	CCNGG	3 cut(s)	250, 675, 709
Mva1269I	GAATGC	1 cut(s)	718
MvaI	CCWGG	3 cut(s)	250, 675, 709
MwoI	GCNNNNNNNGC	4 cut(s)	70, 229, 684, 713
NaeI	GCCGGC	1 cut(s)	290
NdeII	GATC	2 cut(s)	159, 516
NgoMIV	GCCGGC	1 cut(s)	288
NlaIII	CATG	7 cut(s)	24, 120, 166, 212, 445, 554, 583
NlaIV	GGNNCC	4 cut(s)	261, 335, 665, 823
NmuCI	GTSAC	1 cut(s)	629
NsiI	ATGCAT	1 cut(s)	118
NspI	RCATGY	3 cut(s)	120, 212, 554
PceI	AGGCCT	1 cut(s)	707
PciI	ACATGT	1 cut(s)	208
PctI	GAATGC	1 cut(s)	718
PdiI	GCCGGC	1 cut(s)	290
PdmI	GAANNNNTTC	1 cut(s)	244
PfeI	GAWTC	3 cut(s)	245, 479, 622
PflMI	CCANNNNNTGG	2 cut(s)	690, 818
PkrI	GCNGC	2 cut(s)	363, 525
PleI	GAGTC	3 cut(s)	272, 406, 616
PpsI	GAGTC	3 cut(s)	272, 406, 616
Ppu21I	YACGTR	1 cut(s)	815
PscI	ACATGT	1 cut(s)	208
PsiI	TTATAA	1 cut(s)	135
Psp6I	CCWGG	3 cut(s)	248, 673, 707
PspGI	CCWGG	3 cut(s)	248, 673, 707
PspN4I	GGNNCC	4 cut(s)	261, 335, 665, 823
PspPI	GGNCC	4 cut(s)	72, 375, 445, 822
PstNI	CAGNNNCTG	1 cut(s)	526
PsuI	RGATCY	1 cut(s)	516
PvuII	CAGCTG	1 cut(s)	526
RsaI	GTAC	1 cut(s)	665
RsaNI	GTAC	1 cut(s)	664
Rsr2I	CGGWCCG	1 cut(s)	375
RsrII	CGGWCCG	1 cut(s)	375
SatI	GCNGC	2 cut(s)	362, 524
Sau3AI	GATC	2 cut(s)	159, 516
Sau96I	GGNCC	4 cut(s)	72, 375, 445, 822
SchI	GAGTC	3 cut(s)	272, 407, 617
ScrFI	CCNGG	3 cut(s)	250, 675, 709
SfaNI	GCATC	3 cut(s)	717, 732, 762
SinI	GGWCC	1 cut(s)	375
SmlI	CTYRAG	2 cut(s)	506, 826
SmoI	CTYRAG	2 cut(s)	506, 826
Sse9I	AATT	1 cut(s)	167
SseBI	AGGCCT	1 cut(s)	707
SsiI	CCGC	4 cut(s)	463, 735, 765, 795
SspMI	CTAG	3 cut(s)	69, 224, 330
StuI	AGGCCT	1 cut(s)	707
StyD4I	CCNGG	3 cut(s)	248, 673, 707
StyI	CCWWGG	1 cut(s)	68
TaaI	ACNGT	3 cut(s)	375, 629, 635
TaiI	ACGT	1 cut(s)	817
TaqI	TCGA	2 cut(s)	572, 725
TasI	AATT	1 cut(s)	167
TfiI	GAWTC	3 cut(s)	245, 479, 622
TscAI	CASTG	2 cut(s)	425, 634
TseFI	GTSAC	1 cut(s)	629
TseI	GCWGC	2 cut(s)	361, 523
Tsp45I	GTSAC	1 cut(s)	629
TspDTI	ATGAA	1 cut(s)	596
TspGWI	ACGGA	1 cut(s)	283
TspRI	CASTG	2 cut(s)	425, 634
Van91I	CCANNNNNTGG	2 cut(s)	690, 818
VpaK11BI	GGWCC	1 cut(s)	375
XceI	RCATGY	3 cut(s)	120, 212, 554
XmaJI	CCTAGG	1 cut(s)	68
XmnI	GAANNNNTTC	1 cut(s)	244
XspI	CTAG	3 cut(s)	69, 224, 330
Zsp2I	ATGCAT	1 cut(s)	118

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.