Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr14

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Forward (+)

10970738 .. 10971355

Gene Structure 618 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom14g09260.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 618 bp

ATGGTTAACCTATCTAACATTTGCTTAGATTTGAGTCTCAGCAGTGATCCGGGTGCGCCGCGTCAGGGTAATGTATGGTGCCCGTCTTTCTTATCTTCTAATGGCCCTTTTACAGGTGAAGACTCCGTGATGAAGGATGCAACAACAGCTACGATAGTTGCTAGGAACCTCCTCACTCCTAAAGATAGTAGGCTGCTTTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTAGCTCTCAGTGTTCAGTGTGCGGGCTCTGTGTCCAACATGGGCCAACGCCTACTTGCTCGATCCCATCAAGTTAAATCATTGATGGCGGAGGTGGAAAATCTTAAGCAAGAGATCAAACAGCTTAAGCACGAGAATAGAGGTTTGCACGTGCTTGCAAATAATTATTCGACAAGCATGAAGAGGAAGCTTGATCAGCTGCAAGAATCTGAAGGTCAAATTCAAAGTGACCGCCAAAGGCTTGTGGCTTTCTTCCAGAGGCACCTTTTTCCTGCGTCATCTAGCGTTCCACCAAGTATTGAGGCCTCGAATGATCTATCTTCAATGCCTCCCGCTCCTGCAGTTTTGCCAAGTAGTGGGGCTTCACGTAAACAACCTTTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

206

Amino Acids

22.22

Weight (kDa)

8.51

Isoelectric Point (pI)

59.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	78, 495
AccB7I	CCANNNNNTGG	1 cut(s)	590
AccBSI	CCGCTC	1 cut(s)	569
AccII	CGCG	1 cut(s)	61
AciI	CCGC	5 cut(s)	59, 257, 323, 466, 567
AclWI	GGATC	2 cut(s)	41, 291
AcoI	YGGCCR	1 cut(s)	219
AcsI	RAATTY	1 cut(s)	453
AcuI	CTGAAG	1 cut(s)	465
AcvI	CACGTG	1 cut(s)	385
AfiI	CCNNNNNNNGG	3 cut(s)	65, 113, 590
AflII	CTTAAG	2 cut(s)	338, 359
AgsI	TTSAA	3 cut(s)	227, 458, 558
AluBI	AGCT	5 cut(s)	149, 239, 358, 424, 433
AluI	AGCT	5 cut(s)	149, 239, 358, 424, 433
Alw26I	GTCTC	1 cut(s)	41
AlwI	GGATC	2 cut(s)	41, 291
AoxI	GGCC	4 cut(s)	103, 219, 277, 537
ApeKI	GCWGC	2 cut(s)	193, 433
ApoI	RAATTY	1 cut(s)	453
AspLEI	GCGC	1 cut(s)	58
AspS9I	GGNCC	3 cut(s)	104, 207, 277
AsuC2I	CCSGG	1 cut(s)	51
AsuHPI	GGTGA	1 cut(s)	128
AvaII	GGWCC	1 cut(s)	207
BaeGI	GKGCMC	1 cut(s)	83
BanI	GGYRCC	2 cut(s)	78, 495
BanII	GRGCYC	1 cut(s)	263
BarI	GAAGNNNNNNTAC	2 cut(s)	580, 612
BauI	CACGAG	1 cut(s)	365
BbrPI	CACGTG	1 cut(s)	385
BbsI	GAAGAC	1 cut(s)	126
BbvI	GCAGC	2 cut(s)	180, 420
BccI	CCATC	2 cut(s)	309, 313
BceAI	ACGGC	1 cut(s)	206
BclI	TGATCA	1 cut(s)	427
BcnI	CCSGG	1 cut(s)	51
BcoDI	GTCTC	1 cut(s)	41
BfaI	CTAG	3 cut(s)	162, 236, 516
BfmI	CTRYAG	1 cut(s)	573
BfrI	CTTAAG	2 cut(s)	338, 359
BisI	GCNGC	3 cut(s)	59, 194, 434
BlsI	GCNGC	3 cut(s)	60, 195, 435
Bme1390I	CCNGG	1 cut(s)	51
Bme18I	GGWCC	1 cut(s)	207
BmgT120I	GGNCC	3 cut(s)	104, 207, 277
BmiI	GGNNCC	3 cut(s)	80, 167, 497
BmrFI	CCNGG	1 cut(s)	51
BmsI	GCATC	1 cut(s)	127
BpiI	GAAGAC	1 cut(s)	126
BpuMI	CCSGG	1 cut(s)	51
BsaAI	YACGTR	2 cut(s)	385, 602
Bsc4I	CCNNNNNNNGG	3 cut(s)	65, 113, 590
BseGI	GGATG	1 cut(s)	142
BseLI	CCNNNNNNNGG	3 cut(s)	65, 113, 590
BseMII	CTCAG	2 cut(s)	52, 256
BseRI	GAGGAG	1 cut(s)	161
BseSI	GKGCMC	1 cut(s)	83
BseXI	GCAGC	2 cut(s)	180, 420
Bsh1236I	CGCG	1 cut(s)	61
BshFI	GGCC	4 cut(s)	105, 221, 279, 539
BshNI	GGYRCC	2 cut(s)	78, 495
BsiSI	CCGG	1 cut(s)	50
BslFI	GGGAC	1 cut(s)	217
BslI	CCNNNNNNNGG	3 cut(s)	65, 113, 590
BsmAI	GTCTC	1 cut(s)	41
BsmFI	GGGAC	1 cut(s)	217
BsnI	GGCC	4 cut(s)	105, 221, 279, 539
Bsp1286I	GDGCHC	2 cut(s)	83, 263
Bsp143I	GATC	5 cut(s)	46, 296, 348, 427, 547
BspACI	CCGC	5 cut(s)	59, 257, 323, 466, 567
BspANI	GGCC	4 cut(s)	105, 221, 279, 539
BspCNI	CTCAG	2 cut(s)	51, 255
BspFNI	CGCG	1 cut(s)	61
BspLI	GGNNCC	3 cut(s)	80, 167, 497
BspMAI	CTGCAG	1 cut(s)	577
BspPI	GGATC	2 cut(s)	41, 291
BspT107I	GGYRCC	2 cut(s)	78, 495
BspTI	CTTAAG	2 cut(s)	338, 359
BsrBI	CCGCTC	1 cut(s)	569
BssMI	GATC	5 cut(s)	46, 296, 348, 427, 547
BssSI	CACGAG	1 cut(s)	365
Bst2BI	CACGAG	1 cut(s)	365
Bst4CI	ACNGT	1 cut(s)	207
Bst6I	CTCTTC	1 cut(s)	410
BstAFI	CTTAAG	2 cut(s)	338, 359
BstBAI	YACGTR	2 cut(s)	385, 602
BstC8I	GCNNGC	2 cut(s)	259, 390
BstDEI	CTNAG	3 cut(s)	25, 38, 242
BstENI	CCTNNNNNAGG	1 cut(s)	111
BstF5I	GGATG	1 cut(s)	142
BstFNI	CGCG	1 cut(s)	61
BstHHI	GCGC	1 cut(s)	58
BstKTI	GATC	5 cut(s)	49, 299, 351, 430, 550
BstMAI	GTCTC	1 cut(s)	41
BstMBI	GATC	5 cut(s)	46, 296, 348, 427, 547
BstMWI	GCNNNNNNNGC	2 cut(s)	146, 430
BstSCI	CCNGG	1 cut(s)	49
BstSFI	CTRYAG	1 cut(s)	573
BstSLI	GKGCMC	1 cut(s)	83
BstUI	CGCG	1 cut(s)	61
BstV1I	GCAGC	2 cut(s)	180, 420
BstV2I	GAAGAC	1 cut(s)	126
BsuRI	GGCC	4 cut(s)	105, 221, 279, 539
BtsCI	GGATG	1 cut(s)	142
BtsI	GCAGTG	1 cut(s)	49
BtsIMutI	CAGTG	3 cut(s)	49, 250, 257
Cac8I	GCNNGC	2 cut(s)	259, 390
CfoI	GCGC	1 cut(s)	58
Cfr13I	GGNCC	3 cut(s)	104, 207, 277
CpoI	CGGWCCG	1 cut(s)	207
CseI	GACGC	2 cut(s)	50, 498
CspI	CGGWCCG	1 cut(s)	207
CviAII	CATG	2 cut(s)	274, 412
DdeI	CTNAG	3 cut(s)	25, 38, 242
DpnI	GATC	5 cut(s)	48, 298, 350, 429, 549
DpnII	GATC	5 cut(s)	46, 296, 348, 427, 547
EaeI	YGGCCR	1 cut(s)	219
Eam1104I	CTCTTC	1 cut(s)	410
EarI	CTCTTC	1 cut(s)	410
EciI	GGCGGA	1 cut(s)	338
Eco147I	AGGCCT	1 cut(s)	539
Eco24I	GRGCYC	1 cut(s)	263
Eco47I	GGWCC	1 cut(s)	207
Eco57I	CTGAAG	1 cut(s)	465
Eco72I	CACGTG	1 cut(s)	385
EcoNI	CCTNNNNNAGG	1 cut(s)	111
EcoT38I	GRGCYC	1 cut(s)	263
FaeI	CATG	2 cut(s)	277, 415
FaiI	YATR	3 cut(s)	76, 275, 413
FaqI	GGGAC	1 cut(s)	217
FatI	CATG	2 cut(s)	273, 411
FauI	CCCGC	2 cut(s)	250, 574
FbaI	TGATCA	1 cut(s)	427
Fnu4HI	GCNGC	3 cut(s)	59, 194, 434
FokI	GGATG	1 cut(s)	149
FriOI	GRGCYC	1 cut(s)	263
Fsp4HI	GCNGC	3 cut(s)	59, 194, 434
FspBI	CTAG	3 cut(s)	162, 236, 516
GlaI	GCGC	1 cut(s)	57
GluI	GCNGC	3 cut(s)	59, 194, 434
HaeIII	GGCC	4 cut(s)	105, 221, 279, 539
HapII	CCGG	1 cut(s)	50
HgaI	GACGC	2 cut(s)	50, 498
HhaI	GCGC	1 cut(s)	58
Hin1II	CATG	2 cut(s)	277, 415
Hin6I	GCGC	1 cut(s)	56
HinP1I	GCGC	1 cut(s)	56
HincII	GTYRAC	1 cut(s)	7
HindII	GTYRAC	1 cut(s)	7
HindIII	AAGCTT	1 cut(s)	422
HinfI	GANTC	4 cut(s)	34, 122, 230, 440
HpaI	GTTAAC	1 cut(s)	7
HpaII	CCGG	1 cut(s)	50
HphI	GGTGA	1 cut(s)	128
Hpy166II	GTNNAC	2 cut(s)	7, 605
Hpy188I	TCNGA	2 cut(s)	211, 445
Hpy188III	TCNNGA	3 cut(s)	201, 227, 490
Hpy8I	GTNNAC	2 cut(s)	7, 605
HpyAV	CCTTC	2 cut(s)	127, 440
HpyCH4III	ACNGT	1 cut(s)	207
HpyCH4IV	ACGT	2 cut(s)	384, 601
HpyCH4V	TGCA	5 cut(s)	140, 382, 392, 436, 575
HpyF10VI	GCNNNNNNNGC	2 cut(s)	146, 430
HpyF3I	CTNAG	3 cut(s)	25, 38, 242
HpySE526I	ACGT	2 cut(s)	384, 601
Hsp92II	CATG	2 cut(s)	277, 415
HspAI	GCGC	1 cut(s)	56
Ksp22I	TGATCA	1 cut(s)	427
KspAI	GTTAAC	1 cut(s)	7
Kzo9I	GATC	5 cut(s)	46, 296, 348, 427, 547
LmnI	GCTCC	1 cut(s)	574
LpnPI	CCDG	7 cut(s)	50, 63, 99, 186, 503, 519, 585
Lsp1109I	GCAGC	2 cut(s)	180, 420
LweI	GCATC	1 cut(s)	127
MaeI	CTAG	3 cut(s)	162, 236, 516
MaeII	ACGT	2 cut(s)	384, 601
MaeIII	GTNAC	1 cut(s)	461
MalI	GATC	5 cut(s)	48, 298, 350, 429, 549
MbiI	CCGCTC	1 cut(s)	569
MboI	GATC	5 cut(s)	46, 296, 348, 427, 547
MboII	GAAGA	5 cut(s)	87, 131, 427, 478, 546
MhlI	GDGCHC	2 cut(s)	83, 263
MluCI	AATT	2 cut(s)	397, 453
MlyI	GAGTC	3 cut(s)	43, 116, 239
MmeI	TCCRAC	1 cut(s)	294
MnlI	CCTC	9 cut(s)	179, 182, 319, 368, 411, 486, 529, 550, 573
MseI	TTAA	4 cut(s)	6, 309, 339, 360
MspA1I	CMGCKG	1 cut(s)	433
MspCI	CTTAAG	2 cut(s)	338, 359
MspI	CCGG	1 cut(s)	50
MspR9I	CCNGG	1 cut(s)	51
MvnI	CGCG	1 cut(s)	61
MwoI	GCNNNNNNNGC	2 cut(s)	146, 430
NciI	CCSGG	1 cut(s)	51
NdeII	GATC	5 cut(s)	46, 296, 348, 427, 547
NlaIII	CATG	2 cut(s)	277, 415
NlaIV	GGNNCC	3 cut(s)	80, 167, 497
NmuCI	GTSAC	1 cut(s)	461
PceI	AGGCCT	1 cut(s)	539
PfeI	GAWTC	1 cut(s)	440
PflMI	CCANNNNNTGG	1 cut(s)	590
PkrI	GCNGC	3 cut(s)	60, 195, 435
PleI	GAGTC	3 cut(s)	42, 116, 238
PmaCI	CACGTG	1 cut(s)	385
PmlI	CACGTG	1 cut(s)	385
PpsI	GAGTC	3 cut(s)	42, 116, 238
Ppu21I	YACGTR	2 cut(s)	385, 602
PspCI	CACGTG	1 cut(s)	385
PspN4I	GGNNCC	3 cut(s)	80, 167, 497
PspPI	GGNCC	3 cut(s)	104, 207, 277
PstI	CTGCAG	1 cut(s)	577
PvuII	CAGCTG	1 cut(s)	433
Rsr2I	CGGWCCG	1 cut(s)	207
RsrII	CGGWCCG	1 cut(s)	207
SaqAI	TTAA	4 cut(s)	6, 309, 339, 360
SatI	GCNGC	3 cut(s)	59, 194, 434
Sau3AI	GATC	5 cut(s)	46, 296, 348, 427, 547
Sau96I	GGNCC	3 cut(s)	104, 207, 277
SchI	GAGTC	3 cut(s)	43, 116, 239
ScrFI	CCNGG	1 cut(s)	51
SduI	GDGCHC	2 cut(s)	83, 263
SfaNI	GCATC	1 cut(s)	127
SfcI	CTRYAG	1 cut(s)	573
SinI	GGWCC	1 cut(s)	207
SmlI	CTYRAG	2 cut(s)	338, 359
SmoI	CTYRAG	2 cut(s)	338, 359
Sse9I	AATT	2 cut(s)	397, 453
SseBI	AGGCCT	1 cut(s)	539
SsiI	CCGC	5 cut(s)	59, 257, 323, 466, 567
SspMI	CTAG	3 cut(s)	162, 236, 516
StuI	AGGCCT	1 cut(s)	539
StyD4I	CCNGG	1 cut(s)	49
TaaI	ACNGT	1 cut(s)	207
TaiI	ACGT	2 cut(s)	387, 604
TaqI	TCGA	3 cut(s)	295, 404, 542
TasI	AATT	2 cut(s)	397, 453
TauI	GCSGC	1 cut(s)	61
TfiI	GAWTC	1 cut(s)	440
Tru1I	TTAA	4 cut(s)	6, 309, 339, 360
Tru9I	TTAA	4 cut(s)	6, 309, 339, 360
TscAI	CASTG	3 cut(s)	49, 250, 257
TseFI	GTSAC	1 cut(s)	461
TseI	GCWGC	2 cut(s)	193, 433
Tsp45I	GTSAC	1 cut(s)	461
TspDTI	ATGAA	2 cut(s)	146, 428
TspGWI	ACGGA	1 cut(s)	115
TspRI	CASTG	3 cut(s)	49, 250, 257
Van91I	CCANNNNNTGG	1 cut(s)	590
Vha464I	CTTAAG	2 cut(s)	338, 359
VpaK11BI	GGWCC	1 cut(s)	207
XagI	CCTNNNNNAGG	1 cut(s)	111
XapI	RAATTY	1 cut(s)	453
XspI	CTAG	3 cut(s)	162, 236, 516

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.