pycom2424g00030

Chloroplast-localized elongation factor EF-G involved in protein synthesis in plastids. Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A- site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00002424
Physical Location & Seq
Forward (+)
79978 .. 87731
7754 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom2424g00030.5

Sequence Viewer

Length: 1533 bp
ATGAATCAGGCAAACTCATCGAACCTTAGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCGCCCCGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCTTCTTACAGGTGAAGACTCTGTGATGCAGGACGCCATAACAGCTACAATAGTAGCTAAGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTCCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGACTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGGATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTCAAAGGCTTGCGTCTTATCTCCAGAGGCACCTTTTTCCTGGGTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCCGCTCCGATGGCTTCCGCTCCGATGCCTCCCGCTTCTATGCCTCCCGCTTCTATGCCTTCCGCTTCTGCGCCTCGTATAACACAAGCTATCACTTTGGGAAGTGCTATGGAGGTTGGAGCTGACCTAAAAATGTCCAAACATAGCCTAGAAGTGGATGAAGAGCTGCTAATTGAGGAGGAGGAAGAAGACATGCACACGGCAAGGGTAGAACAACCCTTGCCGCAACCCCCTAAGCCCTCTAAACCACCCACCACCAGTAAGGACGTCCCAATTTCATGTTATTCTGATGTTATTCCACCCAATGTCCCTTTTCCTAGCAGGTTTTTGATTCCCAACCAAGAAGAGAGTAAAAAGGACATCGTGGAAGCCTTCCCAAAGGTGCAAAATGCTATTCAAATTCTTGGTGCAACACAAAGAATGATTCAAGAGAAGGTAGTGGCTGGAGAAGATGTAGAAGGCATCAAAGAGGACAAATTTGAAACCACAATTCCCAAGGAAGTTGGATTTTATGACACGGGACAAGTCATAACTTTCGAAGGGGTGTTTATTCTGGAGTTCATTTTGGAGCACACAGGTAAGCCGCATCCCCGAATTTCAATTTTCTTTTATACTAACATGTGGTTAATGATTCAGGCACCCAATCTGGAATTTAAACTATTACCGGATCATTTCAAGTATCACCGCCCATTCAAAGATAAATTCCATCTTCACAAAGGTTGTTTACGTGAAGCCCCACTACGAGGCGCAGAACGGGAGGCATCGGAGCTAGAGCATTCCAGGCCTCAATACTTGGCCAAGCGCTGGATGACCCAGGAAAAAGGTGCCTCTGGAGATAAGACGCAAGCCTTTGACGGTCACTGTGAATTCGACCCTCAGATTCTTGCAGCTCATCAAGCTTCCTTTTCATCCCCGACGAATAGTTATTTGCAAGCACATGCAAACTTCTATTCTCGTACTTAA

Protein Analysis

511

Amino Acids

56.95

Weight (kDa)

5.81

Isoelectric Point (pI)

56.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 840
Acc36I ACCTGC 1 cut(s) 882
AccB1I GGYRCC 4 cut(s) 84, 501, 1207, 1394
AccB7I CCANNNNNTGG 2 cut(s) 528, 1374
AccBSI CCGCTC 3 cut(s) 303, 575, 590
AciI CCGC 9 cut(s) 301, 573, 588, 603, 618, 633, 794, 1154, 1255
AclWI GGATC 3 cut(s) 47, 349, 1245
AcoI YGGCCR 3 cut(s) 225, 530, 1365
AcsI RAATTY 7 cut(s) 459, 969, 1046, 1164, 1220, 1271, 1436
AcyI GRCGYC 3 cut(s) 85, 144, 837
AdeI CACNNNGTG 1 cut(s) 251
AfaI GTAC 2 cut(s) 371, 1528
AfeI AGCGCT 2 cut(s) 526, 1373
AfiI CCNNNNNNNGG 6 cut(s) 71, 313, 528, 724, 1313, 1374
AflII CTTAAG 2 cut(s) 344, 365
AflIII ACRYGT 1 cut(s) 1188
AgsI TTSAA 7 cut(s) 233, 968, 998, 1052, 1170, 1246, 1264
AjnI CCWGG 4 cut(s) 511, 545, 1349, 1383
Alw21I GWGCWC 1 cut(s) 1143
Alw26I GTCTC 1 cut(s) 47
AlwI GGATC 3 cut(s) 47, 349, 1245
Aor51HI AGCGCT 2 cut(s) 526, 1373
AoxI GGCC 6 cut(s) 225, 283, 530, 543, 1352, 1365
ApeKI GCWGC 6 cut(s) 48, 199, 361, 439, 736, 1457
ApoI RAATTY 7 cut(s) 459, 969, 1046, 1164, 1220, 1271, 1436
AspLEI GCGC 6 cut(s) 64, 87, 527, 643, 1319, 1374
AspS9I GGNCC 2 cut(s) 213, 283
AsuHPI GGTGA 2 cut(s) 134, 1244
AsuII TTCGAA 1 cut(s) 1107
AvaII GGWCC 1 cut(s) 213
BalI TGGCCA 2 cut(s) 532, 1367
BanI GGYRCC 4 cut(s) 84, 501, 1207, 1394
BarI GAAGNNNNNNTAC 2 cut(s) 1293, 1325
BbsI GAAGAC 3 cut(s) 104, 132, 765
Bbv12I GWGCWC 1 cut(s) 1143
BbvI GCAGC 6 cut(s) 60, 186, 373, 426, 723, 1469
BccI CCATC 3 cut(s) 319, 574, 1284
BceAI ACGGC 2 cut(s) 212, 786
BcgI CGANNNNNNTGC 3 cut(s) 34, 41, 75
BciT130I CCWGG 4 cut(s) 513, 547, 1351, 1385
BcoDI GTCTC 1 cut(s) 47
BfaI CTAG 4 cut(s) 557, 719, 888, 1340
BfoI RGCGCY 3 cut(s) 88, 528, 1375
BfrI CTTAAG 2 cut(s) 344, 365
BfuAI ACCTGC 1 cut(s) 882
BisI GCNGC 8 cut(s) 49, 200, 362, 440, 737, 794, 1154, 1458
BlsI GCNGC 8 cut(s) 50, 201, 363, 441, 738, 795, 1155, 1459
Bme1390I CCNGG 4 cut(s) 513, 547, 1351, 1385
Bme18I GGWCC 1 cut(s) 213
BmgT120I GGNCC 2 cut(s) 213, 283
BmiI GGNNCC 4 cut(s) 86, 503, 1209, 1396
BmrFI CCNGG 4 cut(s) 513, 547, 1351, 1385
BmsI GCATC 6 cut(s) 126, 555, 585, 1041, 1165, 1340
BpiI GAAGAC 3 cut(s) 104, 132, 765
BpmI CTGGAG 4 cut(s) 479, 1035, 1145, 1422
Bpu10I CCTNAGC 2 cut(s) 26, 804
Bpu14I TTCGAA 1 cut(s) 1107
BsaAI YACGTR 1 cut(s) 1298
BsaHI GRCGYC 3 cut(s) 85, 144, 837
BsaJI CCNNGG 3 cut(s) 512, 1065, 1383
BsaWI WCCGGW 2 cut(s) 55, 1234
BsaXI ACNNNNNCTCC 2 cut(s) 1008, 1038
Bsc4I CCNNNNNNNGG 6 cut(s) 71, 313, 528, 724, 1313, 1374
Bse1I ACTGG 1 cut(s) 828
BseBI CCWGG 4 cut(s) 513, 547, 1351, 1385
BseDI CCNNGG 3 cut(s) 512, 1065, 1383
BseGI GGATG 6 cut(s) 423, 518, 733, 1156, 1383, 1478
BseLI CCNNNNNNNGG 6 cut(s) 71, 313, 528, 724, 1313, 1374
BseMII CTCAG 3 cut(s) 58, 441, 1460
BseNI ACTGG 1 cut(s) 828
BseRI GAGGAG 3 cut(s) 167, 761, 764
BseXI GCAGC 6 cut(s) 60, 186, 373, 426, 723, 1469
BshFI GGCC 6 cut(s) 227, 285, 532, 545, 1354, 1367
BshNI GGYRCC 4 cut(s) 84, 501, 1207, 1394
BsiHKAI GWGCWC 1 cut(s) 1143
BsiSI CCGG 2 cut(s) 56, 1235
BslFI GGGAC 4 cut(s) 223, 824, 863, 1104
BslI CCNNNNNNNGG 6 cut(s) 71, 313, 528, 724, 1313, 1374
BsmAI GTCTC 1 cut(s) 47
BsmFI GGGAC 4 cut(s) 223, 824, 863, 1104
BsmI GAATGC 2 cut(s) 556, 1345
BsnI GGCC 6 cut(s) 227, 285, 532, 545, 1354, 1367
Bsp119I TTCGAA 1 cut(s) 1107
Bsp1286I GDGCHC 1 cut(s) 1143
Bsp143I GATC 3 cut(s) 52, 354, 1237
BspACI CCGC 9 cut(s) 301, 573, 588, 603, 618, 633, 794, 1154, 1255
BspANI GGCC 6 cut(s) 227, 285, 532, 545, 1354, 1367
BspCNI CTCAG 3 cut(s) 57, 442, 1459
BspLI GGNNCC 4 cut(s) 86, 503, 1209, 1396
BspMI ACCTGC 1 cut(s) 882
BspPI GGATC 3 cut(s) 47, 349, 1245
BspQI GCTCTTC 1 cut(s) 726
BspT104I TTCGAA 1 cut(s) 1107
BspT107I GGYRCC 4 cut(s) 84, 501, 1207, 1394
BspTI CTTAAG 2 cut(s) 344, 365
BsrBI CCGCTC 3 cut(s) 303, 575, 590
BsrI ACTGG 1 cut(s) 828
BssECI CCNNGG 3 cut(s) 512, 1065, 1383
BssMI GATC 3 cut(s) 52, 354, 1237
BssNI GRCGYC 3 cut(s) 85, 144, 837
BssT1I CCWWGG 1 cut(s) 1065
Bst2UI CCWGG 4 cut(s) 513, 547, 1351, 1385
Bst4CI ACNGT 6 cut(s) 110, 213, 467, 473, 1427, 1433
Bst6I CTCTTC 3 cut(s) 416, 726, 909
BstACI GRCGYC 3 cut(s) 85, 144, 837
BstAFI CTTAAG 2 cut(s) 344, 365
BstBAI YACGTR 1 cut(s) 1298
BstBI TTCGAA 1 cut(s) 1107
BstC8I GCNNGC 7 cut(s) 293, 297, 301, 396, 483, 1416, 1503
BstDEI CTNAG 8 cut(s) 26, 31, 44, 168, 248, 450, 804, 1446
BstF5I GGATG 6 cut(s) 423, 518, 733, 1156, 1383, 1478
BstH2I RGCGCY 3 cut(s) 88, 528, 1375
BstHHI GCGC 6 cut(s) 64, 87, 527, 643, 1319, 1374
BstKTI GATC 3 cut(s) 55, 357, 1240
BstMAI GTCTC 1 cut(s) 47
BstMBI GATC 3 cut(s) 52, 354, 1237
BstMWI GCNNNNNNNGC 6 cut(s) 152, 436, 551, 581, 1351, 1466
BstNI CCWGG 4 cut(s) 513, 547, 1351, 1385
BstNSI RCATGY 4 cut(s) 392, 766, 1192, 1511
BstSCI CCNGG 4 cut(s) 511, 545, 1349, 1383
BstV1I GCAGC 6 cut(s) 60, 186, 373, 426, 723, 1469
BstV2I GAAGAC 3 cut(s) 104, 132, 765
BstX2I RGATCY 1 cut(s) 354
BstYI RGATCY 1 cut(s) 354
BsuRI GGCC 6 cut(s) 227, 285, 532, 545, 1354, 1367
BtsCI GGATG 6 cut(s) 423, 518, 733, 1156, 1383, 1478
BtsIMutI CAGTG 3 cut(s) 263, 472, 1429
BveI ACCTGC 1 cut(s) 882
Cac8I GCNNGC 7 cut(s) 293, 297, 301, 396, 483, 1416, 1503
CfoI GCGC 6 cut(s) 64, 87, 527, 643, 1319, 1374
Cfr13I GGNCC 2 cut(s) 213, 283
CpoI CGGWCCG 1 cut(s) 213
CseI GACGC 3 cut(s) 152, 474, 1420
Csp6I GTAC 2 cut(s) 370, 1527
CspI CGGWCCG 1 cut(s) 213
CviAII CATG 6 cut(s) 280, 389, 763, 849, 1189, 1508
CviQI GTAC 2 cut(s) 370, 1527
DdeI CTNAG 8 cut(s) 26, 31, 44, 168, 248, 450, 804, 1446
DinI GGCGCC 1 cut(s) 86
DpnI GATC 3 cut(s) 54, 356, 1239
DpnII GATC 3 cut(s) 52, 354, 1237
DraI TTTAAA 1 cut(s) 1225
DraIII CACNNNGTG 1 cut(s) 251
EaeI YGGCCR 3 cut(s) 225, 530, 1365
Eam1104I CTCTTC 3 cut(s) 416, 726, 909
EarI CTCTTC 3 cut(s) 416, 726, 909
Eco130I CCWWGG 1 cut(s) 1065
Eco147I AGGCCT 2 cut(s) 545, 1354
Eco47I GGWCC 1 cut(s) 213
Eco47III AGCGCT 2 cut(s) 526, 1373
EcoRI GAATTC 2 cut(s) 459, 1436
EcoRII CCWGG 4 cut(s) 511, 545, 1349, 1383
EcoT14I CCWWGG 1 cut(s) 1065
EgeI GGCGCC 1 cut(s) 86
EheI GGCGCC 1 cut(s) 86
ErhI CCWWGG 1 cut(s) 1065
FaeI CATG 6 cut(s) 283, 392, 766, 852, 1192, 1511
FaqI GGGAC 4 cut(s) 223, 824, 863, 1104
FatI CATG 6 cut(s) 279, 388, 762, 848, 1188, 1507
FauI CCCGC 4 cut(s) 308, 580, 610, 625
Fnu4HI GCNGC 8 cut(s) 49, 200, 362, 440, 737, 794, 1154, 1458
FokI GGATG 6 cut(s) 430, 505, 740, 1143, 1390, 1465
Fsp4HI GCNGC 8 cut(s) 49, 200, 362, 440, 737, 794, 1154, 1458
FspBI CTAG 4 cut(s) 557, 719, 888, 1340
GlaI GCGC 6 cut(s) 63, 86, 526, 642, 1318, 1373
GluI GCNGC 8 cut(s) 49, 200, 362, 440, 737, 794, 1154, 1458
GsuI CTGGAG 4 cut(s) 479, 1035, 1145, 1422
HaeII RGCGCY 3 cut(s) 88, 528, 1375
HaeIII GGCC 6 cut(s) 227, 285, 532, 545, 1354, 1367
HapII CCGG 2 cut(s) 56, 1235
HgaI GACGC 3 cut(s) 152, 474, 1420
HhaI GCGC 6 cut(s) 64, 87, 527, 643, 1319, 1374
Hin1I GRCGYC 3 cut(s) 85, 144, 837
Hin1II CATG 6 cut(s) 283, 392, 766, 852, 1192, 1511
Hin6I GCGC 6 cut(s) 62, 85, 525, 641, 1317, 1372
HinP1I GCGC 6 cut(s) 62, 85, 525, 641, 1317, 1372
HindIII AAGCTT 2 cut(s) 428, 1467
HpaII CCGG 2 cut(s) 56, 1235
HphI GGTGA 2 cut(s) 134, 1244
Hpy166II GTNNAC 1 cut(s) 1295
Hpy188I TCNGA 9 cut(s) 217, 264, 451, 564, 579, 594, 859, 1336, 1449
Hpy188III TCNNGA 7 cut(s) 207, 233, 496, 998, 1124, 1217, 1401
Hpy8I GTNNAC 1 cut(s) 1295
Hpy99I CGWCG 2 cut(s) 415, 1489
HpyAV CCTTC 6 cut(s) 99, 639, 952, 997, 1022, 1103
HpyCH4III ACNGT 6 cut(s) 110, 213, 467, 473, 1427, 1433
HpyCH4IV ACGT 2 cut(s) 837, 1297
HpyF10VI GCNNNNNNNGC 6 cut(s) 152, 436, 551, 581, 1351, 1466
HpyF3I CTNAG 8 cut(s) 26, 31, 44, 168, 248, 450, 804, 1446
HpySE526I ACGT 2 cut(s) 837, 1297
Hsp92I GRCGYC 3 cut(s) 85, 144, 837
Hsp92II CATG 6 cut(s) 283, 392, 766, 852, 1192, 1511
HspAI GCGC 6 cut(s) 62, 85, 525, 641, 1317, 1372
KasI GGCGCC 1 cut(s) 84
Kzo9I GATC 3 cut(s) 52, 354, 1237
LguI GCTCTTC 1 cut(s) 726
LmnI GCTCC 7 cut(s) 308, 565, 580, 595, 689, 1138, 1336
Lsp1109I GCAGC 6 cut(s) 60, 186, 373, 426, 723, 1469
LweI GCATC 6 cut(s) 126, 555, 585, 1041, 1165, 1340
MaeI CTAG 4 cut(s) 557, 719, 888, 1340
MaeII ACGT 2 cut(s) 837, 1297
MaeIII GTNAC 2 cut(s) 467, 1427
MalI GATC 3 cut(s) 54, 356, 1239
MbiI CCGCTC 3 cut(s) 303, 575, 590
MboI GATC 3 cut(s) 52, 354, 1237
MflI RGATCY 1 cut(s) 354
MhlI GDGCHC 1 cut(s) 1143
MlsI TGGCCA 2 cut(s) 532, 1367
MluNI TGGCCA 2 cut(s) 532, 1367
Mly113I GGCGCC 1 cut(s) 85
MlyI GAGTC 3 cut(s) 49, 122, 245
MmeI TCCRAC 3 cut(s) 300, 667, 1054
Mox20I TGGCCA 2 cut(s) 532, 1367
MscI TGGCCA 2 cut(s) 532, 1367
MseI TTAA 5 cut(s) 345, 366, 1196, 1224, 1531
Msp20I TGGCCA 2 cut(s) 532, 1367
MspCI CTTAAG 2 cut(s) 344, 365
MspI CCGG 2 cut(s) 56, 1235
MspR9I CCNGG 4 cut(s) 513, 547, 1351, 1385
Mva1269I GAATGC 2 cut(s) 556, 1345
MvaI CCWGG 4 cut(s) 513, 547, 1351, 1385
MwoI GCNNNNNNNGC 6 cut(s) 152, 436, 551, 581, 1351, 1466
NarI GGCGCC 1 cut(s) 85
NdeII GATC 3 cut(s) 52, 354, 1237
NlaIII CATG 6 cut(s) 283, 392, 766, 852, 1192, 1511
NlaIV GGNNCC 4 cut(s) 86, 503, 1209, 1396
NmuCI GTSAC 2 cut(s) 467, 1427
NspI RCATGY 4 cut(s) 392, 766, 1192, 1511
NspV TTCGAA 1 cut(s) 1107
PceI AGGCCT 2 cut(s) 545, 1354
PciI ACATGT 1 cut(s) 1188
PciSI GCTCTTC 1 cut(s) 726
PctI GAATGC 2 cut(s) 556, 1345
PfeI GAWTC 7 cut(s) 4, 317, 446, 901, 994, 1201, 1450
PflMI CCANNNNNTGG 2 cut(s) 528, 1374
PkrI GCNGC 8 cut(s) 50, 201, 363, 441, 738, 795, 1155, 1459
PleI GAGTC 3 cut(s) 48, 122, 244
PluTI GGCGCC 1 cut(s) 88
PpsI GAGTC 3 cut(s) 48, 122, 244
Ppu21I YACGTR 1 cut(s) 1298
PscI ACATGT 1 cut(s) 1188
Psp6I CCWGG 4 cut(s) 511, 545, 1349, 1383
PspGI CCWGG 4 cut(s) 511, 545, 1349, 1383
PspN4I GGNNCC 4 cut(s) 86, 503, 1209, 1396
PspPI GGNCC 2 cut(s) 213, 283
PsuI RGATCY 1 cut(s) 354
RsaI GTAC 2 cut(s) 371, 1528
RsaNI GTAC 2 cut(s) 370, 1527
Rsr2I CGGWCCG 1 cut(s) 213
RsrII CGGWCCG 1 cut(s) 213
SapI GCTCTTC 1 cut(s) 726
SaqAI TTAA 5 cut(s) 345, 366, 1196, 1224, 1531
SatI GCNGC 8 cut(s) 49, 200, 362, 440, 737, 794, 1154, 1458
Sau3AI GATC 3 cut(s) 52, 354, 1237
Sau96I GGNCC 2 cut(s) 213, 283
SchI GAGTC 3 cut(s) 49, 122, 245
ScrFI CCNGG 4 cut(s) 513, 547, 1351, 1385
SduI GDGCHC 1 cut(s) 1143
SfaNI GCATC 6 cut(s) 126, 555, 585, 1041, 1165, 1340
SfoI GGCGCC 1 cut(s) 86
SfuI TTCGAA 1 cut(s) 1107
SinI GGWCC 1 cut(s) 213
SmlI CTYRAG 2 cut(s) 344, 365
SmoI CTYRAG 2 cut(s) 344, 365
SseBI AGGCCT 2 cut(s) 545, 1354
SsiI CCGC 9 cut(s) 301, 573, 588, 603, 618, 633, 794, 1154, 1255
SspDI GGCGCC 1 cut(s) 84
SspMI CTAG 4 cut(s) 557, 719, 888, 1340
StuI AGGCCT 2 cut(s) 545, 1354
StyD4I CCNGG 4 cut(s) 511, 545, 1349, 1383
StyI CCWWGG 1 cut(s) 1065
TaaI ACNGT 6 cut(s) 110, 213, 467, 473, 1427, 1433
TaiI ACGT 2 cut(s) 840, 1300
TaqI TCGA 4 cut(s) 20, 457, 1107, 1440
TauI GCSGC 2 cut(s) 796, 1156
TfiI GAWTC 7 cut(s) 4, 317, 446, 901, 994, 1201, 1450
Tru1I TTAA 5 cut(s) 345, 366, 1196, 1224, 1531
Tru9I TTAA 5 cut(s) 345, 366, 1196, 1224, 1531
TscAI CASTG 3 cut(s) 263, 472, 1436
TseFI GTSAC 2 cut(s) 467, 1427
TseI GCWGC 6 cut(s) 48, 199, 361, 439, 736, 1457
Tsp45I GTSAC 2 cut(s) 467, 1427
TspDTI ATGAA 6 cut(s) 17, 434, 744, 837, 1120, 1467
TspRI CASTG 3 cut(s) 263, 472, 1436
Van91I CCANNNNNTGG 2 cut(s) 528, 1374
Vha464I CTTAAG 2 cut(s) 344, 365
VpaK11BI GGWCC 1 cut(s) 213
XapI RAATTY 7 cut(s) 459, 969, 1046, 1164, 1220, 1271, 1436
XceI RCATGY 4 cut(s) 392, 766, 1192, 1511
XspI CTAG 4 cut(s) 557, 719, 888, 1340
ZraI GACGTC 1 cut(s) 838
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.